                                                                        Gene putatively regulated by attenuation in B_halodurans

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:133 nt.    Distance to gene:98 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-10.90 kcal/mol
Antiterminator:    Distance from promoter:115 nt. Size=32 nt.     Delta G= -7.80 kcal/mol
Anti-antiterminator:    Distance from promoter:82 nt.    Size=43 nt.     Delta G= -8.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgctt-tatgat. It has a score value of 76.97 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgctttattcccatcattctgatatgattacttaaacttcatattttcttatccagagtggtggagggactggccctgtgaagcccggcaacctctttt
tttaaagaaggtgccaattccagcagaacatgatgttctgaaagataagaagcgaacggatcgcacgtcttcttatcgaagaggtgttttttcttgtttt
aacaccttatctgtcggaaagattacttgttattgtaccgaaaacagcaagacaaaaaaagaacaacttggaatgaggaggcgttgtacATG

    BH0835 Gene: BH0835     GI: 15613398     BI number: BH0835     GOG: NOG25627     Description:   g t  a a  t cg at at gc         a at       g  t cg        gc g  a       cg a  a      a  c        a c  a      a  a      t  t cg        gc       t  c ta        cg        cg |  t      |  t       ta |  a       gc        ta t  a       at        cg a  g       at        ta a  a       gc       g  g c  a       at        cg cg        at        at gc        ta        cg tg        at        gt                         tttttcttgttttaacaccttatctgtcggaaagattacttgttattgtaccgaaaacagcaagacaaaaaaagaacaacttggaatgaggaggcgttgtacATG                                                                         Genes that have a predicted attenuator with a riboswitch: Methionine_S-box sequence ... can be seen here     ..................................................................................................................