                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:81 nt.    Distance to gene:126 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-12.00 kcal/mol
Antiterminator:    Distance from promoter:50 nt. Size=45 nt.     Delta G= -8.50 kcal/mol
Anti-antiterminator:    Distance from promoter:20 nt.    Size=53 nt.     Delta G=-10.33 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TAGAGA-TATCAT. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TAGAGAAATCTTTCCCAACGCTATCATACGCACACTAAACGGGAACGACCATTTCTTT
ATCGGTGGGTTACCTGAGCTTGTCGCCGATCTTAAACAAGGTAAATCCTAAgggtcatgcgc
ggagcatggctttttttatgttatggacagaaaaaatatttattttgaaaaatacataagcaaaacacgcaaacaccttgcttaaatcgcgcaacatcac
ttataattacttataacaaatcagtaatacttatgagttggtgATG

    BH0847 --- BH0846 Gene: BH0847     GI: 15613410     BI number: BH0847     GOG: COG1349     Description: transcriptional repressor Gene: BH0846     GI: 15613409     BI number: BH0846     GOG: COG0561     Description:   C C  T A  G TA         A TG       A  A GC       T  T GT        GC |  T       GC |  G       AT |  T      A  A GC       C  | TG       A  | GC       A  | GC       A  | CG        TA TA        Tg AT        Cg         g |  C       Tg       c  g T  T       At       g  a T  T       Gc        cg T  A      |  a       gc C  A      C  t       ta T  A       Cg        at T  C       Gc        cg T  A       Cg        tg A  A      T  |       gc CG        Gc        gt CG        Tg        gt AT        Tg        At                         ttttatgttatggacagaaaaaatatttattttgaaaaatacataagcaaaacacgcaaacaccttgcttaaatcgcgcaacatcacttataattacttataacaaatcagtaatacttatgagttggtgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [KG] COG1349 Transcriptional regulators of sugar metabolism ... can be seen here [R] COG0561 Predicted hydrolases of the HAD superfamily ... can be seen here     ..................................................................................................................