                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:112 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G= -9.90 kcal/mol
Antiterminator: Size=20 nt.     Delta G= -4.30 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-16.96 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cttcatgggctcatctgttgtttgattggccttgtggtaccctttttgtggaacgtttaactagactgacgtttccaagttgatggtcaaaaTCACG
AGACGCCTGCGGGAAAAGCAAGAGCTGAAATTCCATCGGGGCGATTTCCCCCGATTAG
CTGAAGCCTTGCTCGCGGCAAGCGAGTGATTTTTGAAACAATCAACCCCATataaattagcc
tctttcgtatcgttatttatcgtgtatttggcctcatttgggtatgataggagggagataaggaaaaggggtcgacgattgatATG

    BH0857 Gene: BH0857     GI: 15613420     BI number: BH0857     GOG: COG0726     Description:   T A  T G  T C  C GC GC GC GC CG TA AT C  T C  A T  G T  C A  T A  G        T         C A  A      C  T      G  A G  |       CG       G  A TA        GC        CG CG        AT        GC GC       |  C       CG A  |      A  G       TA GC        GC        CG AT        TG        GT AT        CG        TG CG        GC        TA                         TTTTTGAAACAATCAACCCCATataaattagcctctttcgtatcgttatttatcgtgtatttggcctcatttgggtatgataggagggagataaggaaaaggggtcgacgattgatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0726 Predicted xylanase/chitin deacetylase ... can be seen here     ..................................................................................................................