                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:199 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -9.90 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -4.09 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G= -9.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGTAAAAGCAGCCATCCCGTTATTGATCGAAAAAGGGTATACCTTTGCTCGTTTAGAT
GAATACGACTTGACCTAActcagagcttatcgggttaggtttttcactttaagaaagtttccctgcatcaacggttaaagattaagg
aaaaatgactgcttcccaaagtaagagttggcggtaagttaaccttttctaacagattcacttcttccaagatgaagtggttgaaatggaaagggaggaa
gaggtagaatagtggaaatattgtataaaaaacaaatgtatatggggagaagacgATG

    BH0858 --- BH0859 Gene: BH0858     GI: 15613421     BI number: BH0858     GOG: COG0385     Description: sodium-dependent transporter Gene: BH0859     GI: 15613422     BI number: BH0859     GOG: NOG41331     Description:   A T  T G  A       CG GC       A  A GC       T  C AT       A  T AT       A  T AT       G  G |  G      T  A        t A  C      A  C      c  t AT        GC       g  a GC        AT        at CG        TA        gc |  T       TA       a  | T  T      |  c       cg A  T      |  t       tg G  A      T  c       cg TG       G  a       At TA        Cg        At AT        Ta        Ta TG        Cg        Cg TA        Gc        Cg                         tttttcactttaagaaagtttccctgcatcaacggttaaagattaaggaaaaatgactgcttcccaaagtaagagttggcggtaagttaaccttttctaacagattcacttcttccaagatgaagtggttgaaatggaaagggaggaagaggtagaatagtggaaatattgtataaaaaacaaatgtatatggggagaagacgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0385 Predicted Na+-dependent transporter ... can be seen here     ..................................................................................................................