                                                                        Gene putatively regulated by attenuation in B_halodurans

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:143 nt.    Distance to gene:40 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-16.70 kcal/mol
Antiterminator:    Distance from promoter:108 nt. Size=48 nt.     Delta G=-20.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttgca-cataat. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttgcaacgagatcagaatatgtcataataaaaagagaatgaataattgcacaggagactaggggtgtctgcttaagtggactgagaaaaaggtgtgttc
cttttaccctcatacctgatctggatcatgccagcgtagggaagtcgactgcacgtgacgatcatcatgggtagccggcatccttatggatggctggctt
tttttattgtatatacaaaacagagaaaagagagaggagaagcaaaATG

    BH1431 --- BH1432 --- BH1433 --- BH1434 --- BH1435 Gene: BH1431     GI: 15613994     BI number: BH1431     GOG: COG0352     Description: thiamine phosphate pyrophosphorylase Gene: BH1432     GI: 15613995     BI number: BH1432     GOG: COG2104     Description: - Gene: BH1433     GI: 15613996     BI number: BH1433     GOG: COG2022     Description: thiamin biosynthesis Gene: BH1434     GI: 15613997     BI number: BH1434     GOG: COG0665     Description: glycine oxidase (sarcosine oxidase) Gene: BH1435     GI: 15613998     BI number: BH1435     GOG: COG0351     Description: phosphomethylpyrimidine kinas at g  c c  a at gc ta gt cg a  g cg gt        ta ta       t  t cg        cg a  c       cg gc        ta cg        at tg       |  g gc        cg a  a       gc at        gt gc        cg gc        cg gt        gc at        at             ttttttattgtatatacaaaacagagaaaagagagaggagaagcaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0352 Thiamine monophosphate synthase ... can be seen here [H] COG2104 Sulfur transfer protein involved in thiamine biosynthesis ... can be seen here [H] COG2022 Uncharacterized enzyme of thiazole biosynthesis ... can be seen here [E] COG0665 Glycine/D-amino acid oxidases (deaminating) ... can be seen here [H] COG0351 Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................