                                                                        Gene putatively regulated by attenuation in B_halodurans

This operon is putativelly rgulated by Lysine_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:65 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-17.80 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -8.60 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G= -8.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tcaaggatgaggtagaggtgcaatgcgaatcagtacccacttggagtttgatggaactaggaagagtggggaaaggtcaatttgccgaagtgaatgtatg
tccatcccatacgtttgctgggtcgtttttgaataaaaaacgaactgccgctgactgttagcggagagctatctgccaatgaggttaccttgcagcattc
aacgtagctagtgtaacacattagctgcgtttttttacgatggttgcagtcggttaaaacgtcactcattgagtttacctataagggagagaaaccatct
ATG

    BH1544 Gene: BH1544     GI: 15614107     BI number: BH1544     GOG: COG0019     Description: diaminopimelate decarboxylas            cc           a  t           t  t            tg            gc gc       g  a a  t      a  g g  a       gc at        ta         a gc        at       a  c gt        at       t  a cg       |  c       gc gc       |  a       ta a  c      |  a       gt ta       c  c       at ta        cg        ta gt        gt        cg |  g       ta        gc |  a       cg        at tg       t  c       tg cg        at        gc at        ta        cg gt        cg        at ta        gt        at                         tttttacgatggttgcagtcggttaaaacgtcactcattgagtttacctataagggagagaaaccatctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0019 Diaminopimelate decarboxylase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Lysine_riboswitch sequence ... can be seen here     ..................................................................................................................