                                                                        Gene putatively regulated by attenuation in B_halodurans

This operon is putativelly rgulated by Riboflavin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:109 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-14.80 kcal/mol
Antiterminator: Size=50 nt.     Delta G=-14.50 kcal/mol
Anti-antiterminator:   Size=27 nt.     Delta G=-10.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gaaggaaacgtacggttcaatttggaaaaatgtgcatgattgcacatcttctttctcgtgggcaaaaaacctacgtatacacaagggagaagtctgtcca
aatggaaccactgcttgtcgcatgacaacgtgcgaatgcattttcgtatgtcaaagtatgccccgtgagaacaaaatctctggggcttttttgcgcgctt
tcaaagaatgacgctcgcttttcgaatcatcctatagaaaaaagggagacgcaagagaacgaaagaaagtttttctaatcgggtaaggtggtaacatgtg
ATG

    ribG --- ribB --- ribA --- ribH Gene: ribG     GI: 15614117     BI number: BH1554     GOG: COG0117,COG1985     Description: riboflavin specific deaminase(diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase) Gene: ribB     GI: 15614118     BI number: BH1555     GOG: COG0307     Description: riboflavin synthase alpha subunit Gene: ribA     GI: 15614119     BI number: BH1556     GOG: COG0108,COG0807     Description: GTP cyclohydrolase II / 3, 4-dihydroxy-2-butanone 4-phosphate synthase Gene: ribH     GI: 15614120     BI number: BH1557     GOG: COG0054     Description: 6,7-dimethyl-8-ribityllumazine synthas            ca           g  t           t  t            at            at            gc            cg            gt            ta            gt            cg            at ca       |  c       aa a  a      |  a      c  a gc       a  a      a  a tg       c  a       at at       a  g       gc cg        gt        at gc        ta        gc cg        at       t  | ta        cg        gt g  a       gc        cg t  t      c  c       cg t  |      t  c       cg cg        gc        cg gc        tg        gc                         ttttttgcgcgctttcaaagaatgacgctcgcttttcgaatcatcctatagaaaaaagggagacgcaagagaacgaaagaaagtttttctaatcgggtaaggtggtaacatgtgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0117 Pyrimidine deaminase ... can be seen here [H] COG1985 Pyrimidine reductase, riboflavin biosynthesis ... can be seen here [H] COG0307 Riboflavin synthase alpha chain ... can be seen here [H] COG0108 3,4-dihydroxy-2-butanone 4-phosphate synthase ... can be seen here [H] COG0807 GTP cyclohydrolase II ... can be seen here [H] COG0054 Riboflavin synthase beta-chain ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Riboflavin_riboswitch sequence ... can be seen here     ..................................................................................................................