                                                                        Gene putatively regulated by attenuation in B_halodurans

This operon is putativelly rgulated by Cobalamin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:125 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-10.90 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -4.60 kcal/mol
Anti-antiterminator:   Size=25 nt.     Delta G= -7.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tgtctagcgacgggaagggggcaagtactcgatgaacataagtcaggagacctgcctttcagtttgagtgtgtagccttcgaggaaaaggtgaagcagtt
catttgatttcatggagatagcatgggatctagactggttttgcaaaaacactctgaagggagtgtttttctttttcacttacgaaagtttaacttccat
taaggttaggcgacaagccaagttttctatgctagtggcccaccaccttcagcgacgagcgccattgattagtacgatagagaaaagaggggattagtag
ATG

    BH1585 --- BH1586 --- BH1587 --- cobD --- cobC --- cobP --- cobQ --- cobS --- BH1593 --- BH1594 --- BH1595 Gene: BH1585     GI: 15614148     BI number: BH1585     GOG: COG0614     Description: ferric ion ABC transpoter (ferric ion-binding protein) Gene: BH1586     GI: 15614149     BI number: BH1586     GOG: COG0609     Description: ferric ion ABC transpoter (permease) Gene: BH1587     GI: 15614150     BI number: BH1587     GOG: COG1120,COG1865     Description: iron(III) dicitrate transport system (permease) Gene: cobD     GI: 15614151     BI number: BH1588     GOG: COG1270     Description: cobalamin biosynthesis Gene: cobC     GI: 15614152     BI number: BH1589     GOG: COG0079     Description: aminotransferase Gene: cobP     GI: 15614153     BI number: BH1590     GOG: COG2087     Description: cobinamide kinase/cobinamide phosphate guanylyltransferase Gene: cobQ     GI: 15614154     BI number: BH1591     GOG: COG1492     Description: cobyric acid synthase Gene: cobS     GI: 15614155     BI number: BH1592     GOG: COG0368     Description: cobalamin synthase Gene: BH1593     GI: 15614156     BI number: BH1593     GOG: COG0406     Description: alpha-ribazole-5'-phosphate phosphatase Gene: BH1594     GI: 15614157     BI number: BH1594     GOG: COG2087     Description: - Gene: BH1595     GI: 15614158     BI number: BH1595     GOG: COG2096     Description:            ga           a  c           t  t            cg            tg            at            gt            gt           g  |           t  |            at   a        cg        aa g  t       gc       g  g a  a      |  a       tg g  g      |  a       cg gc       |  a       ta ta       |  a       cg at       a  a       at cg       t  c       cg t  g      a  a       at t  g       gc        at ta        at        at at        gc        at gc        gt        at                         ctttttcacttacgaaagtttaacttccattaaggttaggcgacaagccaagttttctatgctagtggcccaccaccttcagcgacgagcgccattgattagtacgatagagaaaagaggggattagtagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0614 ABC-type Fe3+-hydroxamate transport system, periplasmic component ... can be seen here [P] COG0609 ABC-type Fe3+-siderophore transport system, permease component ... can be seen here [PH] COG1120 ABC-type cobalamin/Fe3+-siderophores transport systems, ATPase components ... can be seen here [S] COG1865 Uncharacterized conserved protein ... can be seen here [H] COG1270 Cobalamin biosynthesis protein CobD/CbiB ... can be seen here [E] COG0079 Histidinol-phosphate/aromatic aminotransferase and cobyric acid decarboxylase ... can be seen here [H] COG2087 Adenosyl cobinamide kinase/adenosyl cobinamide phosphate guanylyltransferase ... can be seen here [H] COG1492 Cobyric acid synthase ... can be seen here [H] COG0368 Cobalamin-5-phosphate synthase ... can be seen here [G] COG0406 Fructose-2,6-bisphosphatase ... can be seen here [H] COG2087 Adenosyl cobinamide kinase/adenosyl cobinamide phosphate guanylyltransferase ... can be seen here [S] COG2096 Uncharacterized conserved protein ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Cobalamin_riboswitch sequence ... can be seen here     ..................................................................................................................