                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:177 nt.    Distance to gene:24 nt.     Distance to run of Ts=1 nt.   Size=28 nt.     Delta G=-10.70 kcal/mol
Antiterminator:    Distance from promoter:145 nt. Size=44 nt.     Delta G= -4.10 kcal/mol
Anti-antiterminator:    Distance from promoter:127 nt.    Size=43 nt.     Delta G=-12.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTAATG-TACATT. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTAATGCGATGTTGAAAAAAGGATACATTATTCGTTCTGGACGGGCGTTAGGTTATCC
AGCCTGGATTCGTATAACGATTGGCTCAAAAGAACAAAACGACGGCTGTCTCGCAGCA
CTAGCTGATGTTTTAGCAGAGGAATTGACAACGCAACACCTGTCGTAAgggtaggaaagaaaca
gtcccccttcttcgcggcagttaggcgagatctttttccaaaaggggagatctccctttttctgttttttgggtgagaaaggagagaacgtacaTTG

    tyrA --- aroE Gene: tyrA     GI: 15614229     BI number: BH1666     GOG: COG0287     Description: prephenate dehydrogenase Gene: aroE     GI: 15614230     BI number: BH1667     GOG: COG0128     Description: 5-enolpyruvoylshikimate-3-phosphate synthas             g   a       a  t a  a      c  t g  c      g  a a  a      g  g a  g       cg at        gc gc        cg gc       t  | a  |       ta t  |       cg gc        ta        aa gc       t  t      a  a gc       c  |       cg At       c  |       cg At       c  |       tg |  c      c  |      t  | |  t      c  |      t  | |  t      t  |       tg |  c       gc        ta Tg        at        cg Gc       c  t       ta Cg        at        at Tg        at        gc Gc        at        at Ta        gc        gc                         cctttttctgttttttgggtgagaaaggagagaacgtacaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0287 Prephenate dehydrogenase ... can be seen here [E] COG0128 5-enolpyruvylshikimate-3-phosphate synthase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_halodurans                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:173 nt.    Distance to gene:33 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-15.10 kcal/mol Antiterminator:    Distance from promoter:144 nt. Size=44 nt.     Delta G= -4.10 kcal/mol Anti-antiterminator:    Distance from promoter:128 nt.    Size=41 nt.     Delta G=-10.70 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TTAATG-TACATT. It has a score value of 60.24 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTAATGCGATGTTGAAAAAAGGATACATTATTCGTTCTGGACGGGCGTTAGGTTATCC AGCCTGGATTCGTATAACGATTGGCTCAAAAGAACAAAACGACGGCTGTCTCGCAGCA CTAGCTGATGTTTTAGCAGAGGAATTGACAACGCAACACCTGTCGTAAgggtaggaaagaaaca gtcccccttcttcgcggcagttaggcgagatctttttccaaaaggggagatctccctttttctgttttttgggtgagaaaggagagaacgtacaTTG     tyrA --- aroE Gene: tyrA     GI: 15614229     BI number: BH1666     GOG: COG0287     Description: prephenate dehydrogenase Gene: aroE     GI: 15614230     BI number: BH1667     GOG: COG0128     Description: 5-enolpyruvoylshikimate-3-phosphate synthas             a           c  g   a       g  t a  a      g  t g  c      c  a a  a       gg a  g       cg at        tc        aa gc       t  |      a  a gc        cg        cg a  |       ta        cg t  |       tg        tg gc       c  a      t  | gc       c  |      t  | gc       c  |       tg At       c  |       ta At       c  |       cg |  c      t  |       ta |  t      g  |       at |  t       at        gc |  c       cc        at Tg       a  t       gc Gc        at       c  | Cg        at        gc Tg        gt        gc Gc        at        at                         ttttctgttttttgggtgagaaaggagagaacgtacaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0287 Prephenate dehydrogenase ... can be seen here [E] COG0128 5-enolpyruvylshikimate-3-phosphate synthase ... can be seen here     ..................................................................................................................