                                                                        Gene putatively regulated by attenuation in B_halodurans

This operon is putativelly rgulated by Lysine_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:109 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-14.20 kcal/mol
Antiterminator: Size=61 nt.     Delta G=-22.14 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cgttgagaattgtggaaaggggaatttgccgaagctggaagaatctcatgttctgaaggctggttctgtattaaataaatacagaactgtcatatagcgg
atgttgctatatggagggctatctcacgcatcggaatggttgttaatcaacacataccatgcaacaatgagccctctcattgttgcttttttgatgtcgt
atagctttttctttgcgatgaggtcgtatagctctattcaccaatgagacaaccgatcacgtacttcaatttcaaccatgaatagaggaggatgcacgga
ATG

    BH1742 Gene: BH1742     GI: 15614305     BI number: BH1742     GOG: COG0329     Description: dihydrodipicolinate synthas   a t  a t  t gc ta ta gc |  a gc ta at a  a gc gc c  | ta at cg gc c  a       cc a  a      c  t c  c       gc t  a       at c  a       gc t  t       ta a  g       at ta        at cg        cg gc        at gc        at gc        cg at        gc             ttttttgatgtcgtatagctttttctttgcgatgaggtcgtatagctctattcaccaatgagacaaccgatcacgtacttcaatttcaaccatgaatagaggaggatgcacggaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EM] COG0329 Dihydrodipicolinate synthase/N-acetylneuraminate lyase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Lysine_riboswitch sequence ... can be seen here     ..................................................................................................................