                                                                        Gene putatively regulated by attenuation in B_halodurans

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:81 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-17.40 kcal/mol
Antiterminator: Size=66 nt.     Delta G=-12.80 kcal/mol
Anti-antiterminator:   Size=27 nt.     Delta G= -8.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ctttcccttttcgctcagtttctttataatgaaactcgaacttaatagaaataactaggggagtccaatgagctgggctgagaaaaaaacgcgatgaagt
ttttaaaccctcgggacctgatctggatcataccagcgtggggaagttatcatgttataccacacgaatgtattttatgctagggtccgtctgaatgacg
aaaaccctggcttattttattaaaaaaatacactcctattcccaccttttatggattcagaatcttgtcctgacgactacacacgcgaaggagagattcc
ATG

    thiC Gene: thiC     GI: 15614496     BI number: BH1933     GOG: COG0422     Description: thiamin biosynthesis protei            ta           a  c           t  c            ta            gc            ta           a  c            cg            ta           a  a           t  t           t  g           g  t           a  a           a  |            gt            gt            gt         a            gt       g  a            ta       t  t            gt        cg ca        cg        ta t  t       gc        gc a  a       at        cg gc       c  a      |  a gc       c  g      |  a ta       a  |      c  a cg       t  |       ta |  c      a  |       gc tg        cg        gc at        tg        gc g  g       at        at tg        gc        tg cg        gc        cg cg        tg        gc                         ttattttattaaaaaaatacactcctattcccaccttttatggattcagaatcttgtcctgacgactacacacgcgaaggagagattccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0422 Thiamine biosynthesis protein ThiC ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................