                                                                        Gene putatively regulated by attenuation in B_halodurans

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:163 nt.    Distance to gene:22 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-12.40 kcal/mol
Antiterminator:    Distance from promoter:134 nt. Size=40 nt.     Delta G= -3.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgtca-taacct. It has a score value of 70.95 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgtcaaatctgctcgaattatgctaacctaaatgtaacttcataggaatccactaggggtgcaaaccgctgagagagatgttttttagcatcttaaccc
tcattcacctgatctaggtaatactagcgaagggaagtggccatcgtcattactgttcatttatggaactgattgaaattgaacgatgattacaagccac
ttcttttttagacagtggctttttattttgtccgttcaatgaatctaggagGTG

    BH2678 Gene: BH2678     GI: 15615241     BI number: BH2678     GOG: COG0624     Description: acetylornithine deacetylas   c a  g a  a g  t tg ta at         t at       t  t a  a      t  t gc        ta ta        cg ta        ta |  g      |  c a  c       ta gc        cg ta        at c  c       cg at        cg at        gc gc        at gt        at             tttattttgtccgttcaatgaatctaggagGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0624 Acetylornithine deacetylase/Succinyl-diaminopimelate desuccinylase and related deacylases ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_halodurans This operon is putativelly rgulated by Thiamine_Thi-box                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:166 nt.    Distance to gene:29 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -6.50 kcal/mol Antiterminator:    Distance from promoter:128 nt. Size=40 nt.     Delta G= -3.90 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgtca-taacct. It has a score value of 70.95 and is shown in blue Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgtcaaatctgctcgaattatgctaacctaaatgtaacttcataggaatccactaggggtgcaaaccgctgagagagatgttttttagcatcttaaccc tcattcacctgatctaggtaatactagcgaagggaagtggccatcgtcattactgttcatttatggaactgattgaaattgaacgatgattacaagccac ttcttttttagacagtggctttttattttgtccgttcaatgaatctaggagGTG     BH2678 Gene: BH2678     GI: 15615241     BI number: BH2678     GOG: COG0624     Description: acetylornithine deacetylas   a a  t a  t g  g ta ta ac gg t  a ct         t ag       t  t aa       t  t |  t       ta g  t       cg ga        ta tc       |  c a  a       ta ta        cg tg        at tc        cg ac        cg             ctttttattttgtccgttcaatgaatctaggagGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0624 Acetylornithine deacetylase/Succinyl-diaminopimelate desuccinylase and related deacylases ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................