                                                                        Gene putatively regulated by attenuation in B_halodurans

This operon is putativelly rgulated by Glycine_cleavage

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:193 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-25.60 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -6.70 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-11.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

actagaccacctacgaagacatttcctttttacgataaggggaaagaaactttctggtaaccggacagagctttacacaacttactgtgtaaagctctgt
ccttttttggttatatgtaaaaaattgactgatttttagattggaaggggagcgtttttctattggttcaccggctcgcgtaaaaacgagattttaataa
gttgtctgaatgtttaacgttcttttttcattctgacagcggagagaatgctgaaaggtgatgtaaacgattaagacgatcaactttaggagggaagggt
ATG

    BH2816 --- BH2815 --- BH2814 Gene: BH2816     GI: 15615379     BI number: BH2816     GOG: COG0404     Description: aminomethyltransferase Gene: BH2815     GI: 15615378     BI number: BH2815     GOG: COG0403     Description: glycine dehydrogenase subunit 1 Gene: BH2814     GI: 15615377     BI number: BH2814     GOG: COG1003     Description: glycine dehydrogenase subunit cg         a a  a      t  a t  t       gc ta        gc ta        tg tg        cg tg        ta cg       t  c       tt cg        ta       c  a ta        cg       a  c ta       a  a       at ta       a  g       cg |  g      a  |       at a  a       gc        cg c  a       at        at a  a       at        ta gc        at        ta at       |  a       ta at       |  c       cg gt       |  a       gc c  c      g  c       at a  t      g  a       gc t  |      g  a       at cg        gc        cg cg        at        at at        at        gc                         cttttttggttatatgtaaaaaattgactgatttttagattggaaggggagcgtttttctattggttcaccggctcgcgtaaaaacgagattttaataagttgtctgaatgtttaacgttcttttttcattctgacagcggagagaatgctgaaaggtgatgtaaacgattaagacgatcaactttaggagggaagggtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0404 Glycine cleavage system T protein (aminomethyltransferase) ... can be seen here [E] COG0403 Glycine cleavage system protein P (pyridoxal-binding), N-terminal domain ... can be seen here [E] COG1003 Glycine cleavage system protein P (pyridoxal-binding), C-terminal domain ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Glycine_cleavage sequence ... can be seen here     ..................................................................................................................