                                                                        Gene putatively regulated by attenuation in B_halodurans

This operon is putativelly rgulated by Lysine_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:41 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-15.50 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -5.80 kcal/mol
Anti-antiterminator:   Size=26 nt.     Delta G= -5.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cgaaaaccaagagtacacagtctgagagaaatgagaatcgttgacgactgttggaaagggggattcgccgaagtgcagatcggggctcattcccatttgc
gctggacctatgttgaataagcatagggctgtcacaacactagccccaactagtgctgtggagaactatctcacgtagctacgggaatgcgcacgttttt
attttcgtgtacagtacgcaatggtgaggagttttcctgctgttgcgtttttgttttctttatgcgcgatttccaagcgaagaacagaaaggggaaacct
ATG

    lysC Gene: lysC     GI: 15615658     BI number: BH3096     GOG: COG0527     Description: aspartokinase II alpha and beta subunit             a           c  g            at            ta            gc        tt            tg       g  t            gc       a  t           c  a       gc ta       t  a       gc t  t      t  t       at t  t       tg       g  | t  t       tg        tg t  t       at        gc gc        tg        gt cg        ta        tg at        tg        at cg        tg        at g  t       ta        cg c  a      g  |       gc gc        cg        cg ta        at        at                         ttttgttttctttatgcgcgatttccaagcgaagaacagaaaggggaaacctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0527 Aspartokinases ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Lysine_riboswitch sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_halodurans This operon is putativelly rgulated by Lysine_riboswitch                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:48 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-15.50 kcal/mol Antiterminator: Size=40 nt.     Delta G= -5.80 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case cgaaaaccaagagtacacagtctgagagaaatgagaatcgttgacgactgttggaaagggggattcgccgaagtgcagatcggggctcattcccatttgc gctggacctatgttgaataagcatagggctgtcacaacactagccccaactagtgctgtggagaactatctcacgtagctacgggaatgcgcacgttttt attttcgtgtacagtacgcaatggtgaggagttttcctgctgttgcgtttttgttttctttatgcgcgatttccaagcgaagaacagaaaggggaaacct ATG     lysC Gene: lysC     GI: 15615658     BI number: BH3096     GOG: COG0527     Description: aspartokinase II alpha and beta subunit   t t  t tc ag tt        tt tg       g  t tt       a  t t  a       gc t  c       gc g  a       at cg       g  | at        tg ca        gc gc        gt cg        tg gc        at ta        at aa        cg a  |       gc gt        cg gg        at             ttttgttttctttatgcgcgatttccaagcgaagaacagaaaggggaaacctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0527 Aspartokinases ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Lysine_riboswitch sequence ... can be seen here     ..................................................................................................................