Gene putatively regulated by attenuation in B_halodurans

This operon is putativelly rgulated by Lysine_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:79 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-19.00 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -8.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttaagagtaagcgcttggaggatgacaacgaggataagcgccgaaaggaaaactcgccgaagcggaagatgagtcaagcgtcttcttgctggggttgca
ttgaataaatgtaacactgtcacagcagattgctgtggagaactactaacgttgtgatggggtttccttgtgcggataaaagggcaatgggagagatcga
tctcatcattgctctttttttgtgccctaagtaatagatatagaagaagggattcgctgaaaagcgtgattccattacgacgaagaatggaggaacgaat
ATG

    BH3449


Gene: BH3449     GI: 15616011     BI number: BH3449     GOG: COG1757     Description:


 aa        tc
t  a      a  g
a  a      g  a
g  g       at
g  g       gc
 cg        at
 gc        gc
 ta       |  a
g  a       gt
t  t       gc
 tg        ta
 cg        at
 cg        at
 ta        cg
 tg        gc
 ta        gt
g  g       gc
g  a       at
 gt        at
 gc        at
            ttttgtgccctaagtaatagatatagaagaagggattcgctgaaaagcgtgattccattacgacgaagaatggaggaacgaatATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[C] COG1757 Na+/H+ antiporter ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Lysine_riboswitch sequence ... can be seen here
    ..................................................................................................................