                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:44 nt.    Distance to gene:25 nt.     Distance to run of Ts=2 nt.   Size=35 nt.     Delta G=-11.90 kcal/mol
Antiterminator:    Distance from promoter:11 nt. Size=48 nt.     Delta G= -9.60 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-10.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgtcg-tatatt. It has a score value of 68.94 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgtcgaaaagctatttatctactatattatatgttttcaacatttaatgtgtacgaatggtaagcgccatttgctctttttttgtgttctataacagag
aaagacgccattttctaagaaaaggagggacgtgccggaagATG

    dnaA Gene: dnaA     GI: 16077069     BI number: BSU00010     GOG: COG0593     Description:   t t  c ta ta gc        ag ta       a  c at        tg t  t       gc at        gc ta        ta ta        at        ct at        at       t  a tg        gt       t  t at        cg       g  a t  |      a  c       ta cg       t  t       gc at       g  c       ta ta       t  t       tg c  c      g  t       ta t  |      t  t       tg a  |       at        ta tg        at        ta ta       t  t       ta ta       t  t       cg at        tg        ta tg        at       |  c cg        cg        cg gt        at        gc                         cattttctaagaaaaggagggacgtgccggaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0593 ATPase involved in DNA replication initiation ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_subtilis                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:172 nt.    Distance to gene:56 nt.     Distance to run of Ts=1 nt.   Size=20 nt.     Delta G= -7.30 kcal/mol Antiterminator:    Distance from promoter:136 nt. Size=39 nt.     Delta G= -6.30 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgcaa-tattat. It has a score value of 68.27 and is shown in blue Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgcaagctctcgtttattttggtattatatttgtgttttaactcttgattactaatcctacctttcctctttatccacaaagtgtggataagttgtgga ttgatttcacacagcttgtgtagaaggttgtccacaagttgtgaaatttgtcgaaaagctatttatctactatattatatgttttcaacatttaatgtgt acgaatggtaagcgccatttgctctttttttgtgttctataacagagaaagacgccattttctaagaaaaggagggacgtgccggaagATG     dnaA Gene: dnaA     GI: 16077069     BI number: BSU00010     GOG: COG0593     Description:   t t  c ta ta gc ta at t  t at ta ta at        ag tg       a  c at        tg t  |       gc cg        gc at        ta ta        at |  c       at cg        gt ta        cg             ctctttttttgtgttctataacagagaaagacgccattttctaagaaaaggagggacgtgccggaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0593 ATPase involved in DNA replication initiation ... can be seen here     ..................................................................................................................