Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:95 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-11.30 kcal/mol
Antiterminator: Size=74 nt.     Delta G= -4.61 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-10.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCTGGTATGGGGTATTGCGGGTCCAAAGATCTGCGTGCGCTAAGAGAAGAAGCTCAG
TTCATTCGCATGACTGGCGCAGGACTTCGCGAAAGCCATCCGCATGACGTACAGATTA
CAAAAGAATCACCTAACTATACAATTTCATAAtaaattgttacaaattaaaaacatttgacagggtctctgactct
gtctattttttttatactgattatgataaaatttatactgttgtgcattgaaaatgtccttaacggcttaattatagatgaagaaaatgaaatacggagg
tcgtacgaTTG

    dacA


Gene: dacA     GI: 16077078     BI number: BSU00100     GOG: COG1686     Description: D-alanyl-D-alanine carboxypeptidase (penicillin-binding protein 5


           TA
          A  A
          C  t
           Ta
           Ta
           Ta
           At
           At
           Cg
           At
 AA       T  t
G  A      A  a
 CG       T  c
 GC       C  a
C  C      A  a
T  A      A  a
T  |      T  t
C  |      C  t
 AT       C  a
 GC       A  a
 GC       C  a
|  G      T  a
|  C      A  a
|  A      A  c
 AT       G  a
 CG        At
|  A       At
 GC        At         c
 CG       |  g      t  t
 GT       |  a       cg
|  A      A  c       ta
 GC       C  a       gc
 TA       A  g       gt
 CG        Tg        gc
|  A       Tg        at
 AT        At        cg
 GT        Gc        at
 TA        At        gc
                        tattttttttatactgattatgataaaatttatactgttgtgcattgaaaatgtccttaacggcttaattatagatgaagaaaatgaaatacggaggtcgtacgaTTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[M] COG1686 D-alanyl-D-alanine carboxypeptidase ... can be seen here

    ..................................................................................................................