Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:80 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-11.10 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -3.50 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G= -7.77 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCCTTTCTTCCGCTATACTGATGCAGAAAACAGAAGGCACGAGGTATGGTTCGAGGAT
GCCCGCTCGATTCAAGCAAAATTCAATCTGATTAAAGAGCTGAATTTAAGAGGCATCA
GCTATTGGAAGCTGGGTCTTTCCTTTCCACAAAACTGGCTGCTGCTGTCTGATCAATT
TAATGTTGTCAAAAAGACGTTTCGATAAtttggaaacgtctttttttcatgggggcacccaagggttgtgatacaatat
gaaggtcggtaactgacgcacgtttttcagatataaggaggattccgATG

    dgk --- dck


Gene: dgk     GI: 16077083     BI number: BSU00150     GOG: COG1428     Description: deoxyguanosine kinase
Gene: dck     GI: 16077082     BI number: BSU00140     GOG: COG1428     Description: deoxyadenosine/deoxycytidine kinas


 CC
T  A
T  C
T  A
C  A
C  A
T  A
T  C
T  T
 CG         A
 TG       T  A
 GC       T  T        A
 GT        TG       A  t
|  G       AT       T  t
G  C       AT       A  t
T  T       CG       G  g
 CG       |  T       Cg
 GC       |  C       Ta
 AT       |  A       Ta
|  G      T  A       Ta
 AT       A  A       Gc
 GC       G  A       Cg
G  T       TA        At
T  G       CG        Gc
 TA        TA        At
 AT        GC        At
                        tttttcatgggggcacccaagggttgtgatacaatatgaaggtcggtaactgacgcacgtttttcagatataaggaggattccgATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[F] COG1428 Deoxynucleoside kinases ... can be seen here
[F] COG1428 Deoxynucleoside kinases ... can be seen here

    ..................................................................................................................