                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:78 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-13.80 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -3.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTTAAGTAAGTGGTGTTGACGTTTGGGTCCTGCGCAATGGGAATTCATGAACCATGTC
AGGTCCGGAAGGAAGCAGCATTAAGTGAAACCTCTCATGTGCCGCAGGGTTGCCTGGG
CCGAGCTAACTGCTTAAGTAACGCTTAGGGTAGCGAATCGACAGAAGGTGCACGGTAA
ATCAATCATCAAATTTTCAGACTCACCTAATATTAGGTGAGTTTTttgttatgtaaaaagagctttt
ggaatcgaaacaaggttcatgtataatgggaatgatgaataacggaggagggcaaacccGTG

    dnaX --- yaaK --- recR --- yaaL Gene: dnaX     GI: 16077087     BI number: BSU00190     GOG: COG2812     Description: DNA polymerase III (gamma and tau subunits) Gene: yaaK     GI: 16077088     BI number: BSU00200     GOG: COG0718     Description: - Gene: recR     GI: 16077089     BI number: BSU00210     GOG: COG0353     Description: - Gene: yaaL     GI: 16077090     BI number: BSU00220     GOG: NOG17258     Description: TC A  A C  A TA AT AT C  T T  T A  C A  A       TA A  G      A  T TA        AT GC        TA GT        CG C  |       CG A  |       AT C  |       CG GC        TA TA        CG GC        AT GC        GT AT        AT             TttgttatgtaaaaagagcttttggaatcgaaacaaggttcatgtataatgggaatgatgaataacggaggagggcaaacccGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG2812 DNA polymerase III, gamma/tau subunits ... can be seen here [S] COG0718 Uncharacterized protein conserved in bacteria ... can be seen here [L] COG0353 Recombinational DNA repair protein (RecF pathway) ... can be seen here     ..................................................................................................................