                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:105 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-13.90 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -4.19 kcal/mol
Anti-antiterminator:   Size=59 nt.     Delta G=-13.82 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTAAATATGAGCTGGCTAAAGACCTTGGTTTTTATGACACAGTAAAAAATGGAGGCT
GGGGTGAAATTCGGGCCCGCGATGCCGGTAACATGGTGAAGCGTGCTATTGAAATCGC
CGAACAGCAAATGGCTCAGAATCAGAATAACCGATAAggatgtgacccgggggacgtgctgttccctggtttt
tttattttggatataaatacataatgggctgaatatggatatgttcatcctgtacttcaaatgtgatacaatgttcatacttatgtttagatggagaagt
aggtgaaagctATG

    ispE --- purR --- yabJ Gene: ispE     GI: 16077114     BI number: BSU00460     GOG: COG1947     Description: 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase Gene: purR     GI: 16077115     BI number: BSU00470     GOG: COG0503     Description: transcriptional regulator Gene: yabJ     GI: 16077116     BI number: BSU00480     GOG: COG0251     Description: GA T  A G  G GC TG AT CG A  C AT TA GT         T GT       A  A CG       G  A C  A       Cg G  A       Cg TA       A  a AT        At GC        Tg CG        At GC       A  g |  C      G  a |  G      A  c |  A      C  c |  A      T  c        g |  C      A  g      t  c |  A      A  g      g  t |  G      G  |       cg |  C      A  |       at |  A       Cg        gt |  A       Tg        gc |  A       Cg        gc C  T      G  a       gc CG        Gc        gt CG        Tg        cg GC        At        cg                         tttttttattttggatataaatacataatgggctgaatatggatatgttcatcctgtacttcaaatgtgatacaatgttcatacttatgtttagatggagaagtaggtgaaagctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG1947 4-diphosphocytidyl-2C-methyl-D-erythritol 2-phosphate synthase ... can be seen here [F] COG0503 Adenine/guanine phosphoribosyltransferases and related PRPP-binding proteins ... can be seen here [J] COG0251 Putative translation initiation inhibitor, yjgF family ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_subtilis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:112 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-10.60 kcal/mol Antiterminator: Size=47 nt.     Delta G= -4.19 kcal/mol Anti-antiterminator:   Size=61 nt.     Delta G=-15.42 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTTAAATATGAGCTGGCTAAAGACCTTGGTTTTTATGACACAGTAAAAAATGGAGGCT GGGGTGAAATTCGGGCCCGCGATGCCGGTAACATGGTGAAGCGTGCTATTGAAATCGC CGAACAGCAAATGGCTCAGAATCAGAATAACCGATAAggatgtgacccgggggacgtgctgttccctggtttt tttattttggatataaatacataatgggctgaatatggatatgttcatcctgtacttcaaatgtgatacaatgttcatacttatgtttagatggagaagt aggtgaaagctATG     ispE --- purR --- yabJ Gene: ispE     GI: 16077114     BI number: BSU00460     GOG: COG1947     Description: 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase Gene: purR     GI: 16077115     BI number: BSU00470     GOG: COG0503     Description: transcriptional regulator Gene: yabJ     GI: 16077116     BI number: BSU00480     GOG: COG0251     Description: GA T  A G  G GC TG AT CG A  C AT TA GT GT         A CG       G  T C  A      C  A G  A       CA TA        Ag AT       A  g GC        Ta CG        At GC        Ag |  C      G  t |  G      A  g |  A      C  a |  A      T  c |  C      A  c |  A      A  c        g |  G      G  g      t  c |  C      A  |      g  t |  A      C  |       cg |  A       Tg        at |  A       Cg        gt C  T       Gg        gc CG       G  g       gc CG        Ta        gc GC        Ac        gt GT        Ag        cg                         gtttttttattttggatataaatacataatgggctgaatatggatatgttcatcctgtacttcaaatgtgatacaatgttcatacttatgtttagatggagaagtaggtgaaagctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG1947 4-diphosphocytidyl-2C-methyl-D-erythritol 2-phosphate synthase ... can be seen here [F] COG0503 Adenine/guanine phosphoribosyltransferases and related PRPP-binding proteins ... can be seen here [J] COG0251 Putative translation initiation inhibitor, yjgF family ... can be seen here     ..................................................................................................................