                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:125 nt.     Distance to run of Ts=2 nt.   Size=36 nt.     Delta G=-16.40 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -5.49 kcal/mol
Anti-antiterminator:   Size=18 nt.     Delta G= -7.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCTATTAATTCAAGCACGCGAGGAAAGATTCAAGATGCCGTGTTAAATGAGTATCATC
GTCTGGGTGACACTGAAGCATTAGAATTCGAAGAAGCTGGAGCTTCTTAAaaaataaccaaaa
agcaaggactgctgaaagggctgacataagccttttgccggcggtccttttttaattctgatttttcaaacttagttgcactcaatagaaaattcttgca
cttcatgaagtctccttgaaatcagaagatatttaggatatatttttctatggataaaagggatattggaggccaataaATG

    gcaD --- prs Gene: gcaD     GI: 16077118     BI number: BSU00500     GOG: COG1207     Description: UDP-N-acetylglucosamine pyrophosphorylase Gene: prs     GI: 16077119     BI number: BSU00510     GOG: COG0462     Description: phosphoribosylpyrophosphate synthetas             g           g  a           a  c            at            cg            gc            at           a  g           a  |           a  |           a  |           c  |       ca           c  |      a  t           a  |      g  a           a  |       ta           t  |       cg           a  |       gc           a  |       gc           a  |       gt           a  |       at           A  |       at GG       A  |       at T  A       Ta       |  g CG        Ta       |  c GC       C  a       gc AT       T  g       tg AT        Tg        cg GC        Cg        gc AT        Gc        tg AT        At        cg                         tccttttttaattctgatttttcaaacttagttgcactcaatagaaaattcttgcacttcatgaagtctccttgaaatcagaagatatttaggatatatttttctatggataaaagggatattggaggccaataaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG1207 N-acetylglucosamine-1-phosphate uridyltransferase (contains nucleotidyltransferase and I-patch acetyltransferase domains) ... can be seen here [FE] COG0462 Phosphoribosylpyrophosphate synthetase ... can be seen here     ..................................................................................................................