                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:208 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G=-13.00 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -4.60 kcal/mol
Anti-antiterminator:   Size=24 nt.     Delta G= -5.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCTCTTCAGCGCCGATGGTAGTCGGGGGTTTCCCCCTGTGAGAGTAGGACGCCGCCAA
GCaagcttaaacccagctcaatgagctgggttttttgtattttggtttattggtatcataaaattccacttaactgtataatataataactttataccg
aattttaaatcagcaatcaggttttgtggaccgggaaaatggaaataatgaaggatagagcgagaaagttgaaaattctcgagaaacggcttatagtaag
attaaagtcaaatatagtcaaagtcagtaaaggagggggttgaGTG

    Leu1 --- trnJ --- Gly --- trnJ Gene: ctsR     GI: 16077151     BI number: BSU00830     GOG: COG4463     Description: transcriptional regulator Gene: mcsA     GI: 16077152     BI number: BSU00840     GOG: COG3880     Description: - Gene: mcsB     GI: 16077153     BI number: BSU00850     GOG: COG3869     Description: - Gene: clpC     GI: 16077154     BI number: BSU00860     GOG: COG0542     Description: class III stress response-related ATPas             G           A  C           A  a           C  a            Cg            Gc   G       |  t A  G      C  t TA       C  a GC       G  a        a A  G      C  a      a  t GC       A  c       cg GC        Gc        ta TG        Gc        cg GC       A  a       gc a  |       Tg        at gC        Gc        cg tA        At        cg tA        Gc        cg                         ttttttgtattttggtttattggtatcataaaattccacttaactgtataatataataactttataccgaattttaaatcagcaatcaggttttgtggaccgggaaaatggaaataatgaaggatagagcgagaaagttgaaaattctcgagaaacggcttatagtaagattaaagtcaaatatagtcaaagtcagtaaaggagggggttgaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG4463 Transcriptional repressor of class III stress genes ... can be seen here [S] COG3880 Uncharacterized protein with conserved CXXC pairs ... can be seen here [E] COG3869 Arginine kinase ... can be seen here [O] COG0542 ATPases with chaperone activity, ATP-binding subunit ... can be seen here     ..................................................................................................................