                                                                        Gene putatively regulated by attenuation in B_subtilis

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:178 nt.    Distance to gene:40 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-23.70 kcal/mol
Antiterminator:    Distance from promoter:157 nt. Size=34 nt.     Delta G=-10.40 kcal/mol
Anti-antiterminator:    Distance from promoter:116 nt.    Size=53 nt.     Delta G=-16.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-taggcc. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agagtggaaccgcg is shown in italic-bold style

ttgacagggaagagtataaagctttaggccattacagaaaggatcttcattggctgagagagatccatgagccgggttttagaagtgcgcccttaagacc
tttgaagaacgttttttgaaatcagtattcaaaggcggccgccgccgttacaggctgaagttgggagagcagaagtctgcttttcaaacagagtggaaccgcgcggttaaagcgtctctgtcatgtttacatgcagagacgctttttttattgggtagaggaaatcagatagagaaacggggggaagcatGTG

    Ala --- rrnW --- 16S --- rrnW --- 23S Gene: cysE     GI: 16077161     BI number: BSU00930     GOG: COG1045     Description: serine acetyltransferase Gene: cysS     GI: 16077162     BI number: BSU00940     GOG: COG0215     Description: cysteinyl-tRNA synthetase Gene: yazC     GI: 16077163     BI number: BSU00950     GOG: COG1939     Description: - Gene: yacO     GI: 16077164     BI number: BSU00960     GOG: COG0566     Description: - Gene: yacP     GI: 16077165     BI number: BSU00970     GOG: COG3688     Description: ag a  t gc at cg gc at gt at gt        cg        tt gc       g  c      t  a g  a       cg        gc t  a       cg        ta t  a       at        at g  |       at        cg a  |      |  a      t  | a  |      |  a       gc gc       |  a       ta ta       g  g       cg cg        gc        ta g  a       tg        cg g  g      |  t       ta at        gc        gc cg        at        cg a  g       gc        gc ta        at        at ta        cg        at gc        at        at                         ttttattgggtagaggaaatcagatagagaaacggggggaagcatGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1045 Serine acetyltransferase ... can be seen here [J] COG0215 Cysteinyl-tRNA synthetase ... can be seen here [S] COG1939 Uncharacterized protein conserved in bacteria ... can be seen here [J] COG0566 rRNA methylases ... can be seen here [R] COG3688 Predicted RNA-binding protein containing a PIN domain ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................