                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:62 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-10.50 kcal/mol
Antiterminator: Size=69 nt.     Delta G=-16.70 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G=-13.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCTCTAAAGCGAGGTTCAGTAAAGGAAGTAGTCGTTGCCAAAGACGCAGATCCGATA
CTCACGTCAAGTGTTGTTTCACTTGCTGAAGATCAAGGTATCTCTGTCTCAATGGTTG
AATCCATGAAAAAGCTCGGCAAAGCCTGCGGAATTGAGGTAGGAGCAGCCGCTGTTGC
CATTATTTTATAAcgtacttttgtttttgcgtcagattccatcttgtgtaaagacattgttttttgccttttgatgaaccacctgggtatg
tgggttataaaacgtaatgaagggaggaaaaattcATG

    cysE Gene: rpsL     GI: 16077178     BI number: BSU01100     GOG: COG0048     Description: ribosomal protein S12 (BS12             A           T  T           T  T           A  T           C  T           C  A   T        GT A  T       TA A  G       TA G  A       Gc G  G       Tg CG       |  t GT       C  a TA       G  c CG       C  t CG       C  t G  A       Gt A  G       At A  C       Cg         c A  A       Gt       t  c CG        At        ta GC        Gt        at GC        Gt        gc CG        At        at |  C       Tg       c  t T  T       Gc       t  g CG       G  g       gt GT        At        cg AT        Gc        gt A  G       Ta        ta A  C      |  g       ta A  |       Ta        ta A  |       At        tg GC        At        ta TA        Gc        gc AT        Gc        ta                         ttgttttttgccttttgatgaaccacctgggtatgtgggttataaaacgtaatgaagggaggaaaaattcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0048 Ribosomal protein S12 ... can be seen here     ..................................................................................................................