Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:202 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G= -8.00 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -5.30 kcal/mol
Anti-antiterminator:   Size=30 nt.     Delta G= -6.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tgccaaatgagaggaaagatattactgtcattaaaacgattcttggtttcatccggatatgataaaatgtctcagactatatttgagccatttttttctt
cagcaatcatcttgcgtaattgataaaaatttattatgatactctttgtatgacaactccttgcctcaatacaatatactcaacgtttccccgttttctc
cggtcgtttttcttttcattttctcccgtaaaataaaaaaagctcccaatacaatagatatggtgcggatttattttttactaaaaaggagtcgttatat
TTG

    Pro


Gene: ybaR     GI: 16077226     BI number: BSU01580     GOG: COG0659     Description:


           ta
          a  a
          g  a
           ta
  t        at         a
t  c       tg       t  t
 ta        at       c  a
 gt        gc        at
 gc        gt        gt
t  |      c  c       at
 Gc       c  |       cg
 Tg       t  |       ta
 Tg       a  |       cg
 ta       c  |      t  c
 at        ta        gc
 ta        tg        ta
 at        ta        at
 tg        gc        at
 ta        gt        at
 gt        ta        at
                        tttcttcagcaatcatcttgcgtaattgataaaaatttattatgatactctttgtatgacaactccttgcctcaatacaatatactcaacgtttccccgttttctccggtcgtttttcttttcattttctcccgtaaaataaaaaaagctcccaatacaatagatatggtgcggatttattttttactaaaaaggagtcgttatatTTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[P] COG0659 Sulfate permease and related transporters (MFS superfamily) ... can be seen here

    ..................................................................................................................