                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:133 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-16.40 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -7.10 kcal/mol
Anti-antiterminator:   Size=32 nt.     Delta G= -6.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGAAAAGTATATGGCCTCTGCTGGACAAGTCACCGGTCAGATTGAAGAAATCAATCA
GTTATTCGACTGGACATGGTACAAGATGAAGTCTGCGGGGAAAAGTGTACTCGATGCA
TTCAATCCGAACGGAGAAGAGTAAagcgcgttagccgctttgctctttttttgcgggctgagagggctggcacatttcactt
gctaaatcgaaatgtggtataatgggctcgctatgtaaagtacatatgcgtaacacgtaaaacacaaaatacgaaatgactgaaatcttggaggacgagg
aaATG

    Tyr1 --- trnSL --- Gln2 Gene: ybbP     GI: 16077243     BI number: BSU01750     GOG: COG1624     Description: - Gene: ybbR     GI: 16077244     BI number: BSU01760     GOG: COG4856     Description: - Gene: ybbT     GI: 16077245     BI number: BSU01770     GOG: COG1109     Description:            AA           G  C            CG            CG            TA   C       |  G T  G      A  A       tt C  A      A  A      g  a AT        CG        cg TG        TA        gc GC        TG       |  c TA        AT        cg GT       |  A       gc AT       |  A       at A  C      |  a       At A  A      |  g       At A  A      |  c       Tg G  |       Cg        Gc GT        Gc        At GC        Tg        Gc GC        At        At CG        Gt        At                         tttttgcgggctgagagggctggcacatttcacttgctaaatcgaaatgtggtataatgggctcgctatgtaaagtacatatgcgtaacacgtaaaacacaaaatacgaaatgactgaaatcttggaggacgaggaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1624 Uncharacterized conserved protein ... can be seen here [S] COG4856 Uncharacterized protein conserved in bacteria ... can be seen here [G] COG1109 Phosphomannomutase ... can be seen here     ..................................................................................................................