                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:58 nt.    Distance to gene:56 nt.     Distance to run of Ts=1 nt.   Size=31 nt.     Delta G= -9.60 kcal/mol
Antiterminator:    Distance from promoter:32 nt. Size=32 nt.     Delta G= -6.90 kcal/mol
Anti-antiterminator:    Distance from promoter:9 nt.    Size=29 nt.     Delta G= -4.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttaca-taattt. It has a score value of 76.97 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttacattcgctccggactatgataatttaagaaagcgctatcatgataagttaatagcttggatggagatgaggagagccaggaatccaaccccttttg
acaaggggtgttttctggctctttttgtttttcgggaaaggaggcacgccacacatccagcacaaacagcaaagggggataattattaATG

    glpT Gene: glpT     GI: 16077283     BI number: BSU02140     GOG: COG2271     Description: glycerol-3-phosphate permeas                       g                     t  a   a                 t  c a  t       ga        ta t  a      a  g       ta tg        gc        cg gc        gc        cg at       a  a       cg at       g  g       cg tg       t  g       at a  |      a  a      |  g g  |      g  a      |  t t  |       at       |  t a  |       gc       |  t cg        gc       |  t ta        ta       |  c at       a  a       at tg        gc        cg cg        gc        cg                         ctctttttgtttttcgggaaaggaggcacgccacacatccagcacaaacagcaaagggggataattattaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG2271 Sugar phosphate permease ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_subtilis                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:51 nt.    Distance to gene:62 nt.     Distance to run of Ts=2 nt.   Size=37 nt.     Delta G=-14.90 kcal/mol Antiterminator:    Distance from promoter:22 nt. Size=32 nt.     Delta G= -6.90 kcal/mol Anti-antiterminator:   Size=53 nt.     Delta G= -6.53 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: tttaca-taattt. It has a score value of 76.97 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case tttacattcgctccggactatgataatttaagaaagcgctatcatgataagttaatagcttggatggagatgaggagagccaggaatccaaccccttttg acaaggggtgttttctggctctttttgtttttcgggaaaggaggcacgccacacatccagcacaaacagcaaagggggataattattaATG     glpT Gene: glpT     GI: 16077283     BI number: BSU02140     GOG: COG2271     Description: glycerol-3-phosphate permeas   c g  t c  a g  t a  c a  a a  t g  g a  a                  g at                 t  a ta                 t  c ta                  ta tg        ga        ta at       g  g       cg at        ta        cg ta        at        cg a  |      g  g       cg g  |      g  a       at ta       t  g      a  g at       t  g      c  t ta       c  a      c  | cg        gg       t  | a  c       aa        at g  t       tg        at gt        ac        gt cg       a  c       gc cg        ta        at ta        tg        cg                         gctctttttgtttttcgggaaaggaggcacgccacacatccagcacaaacagcaaagggggataattattaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG2271 Sugar phosphate permease ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_subtilis                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:61 nt.    Distance to gene:73 nt.     Distance to run of Ts=1 nt.   Size=19 nt.     Delta G= -9.10 kcal/mol Antiterminator:    Distance from promoter:22 nt. Size=32 nt.     Delta G= -6.90 kcal/mol Anti-antiterminator:   Size=53 nt.     Delta G= -6.53 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: tttaca-taattt. It has a score value of 76.97 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case tttacattcgctccggactatgataatttaagaaagcgctatcatgataagttaatagcttggatggagatgaggagagccaggaatccaaccccttttg acaaggggtgttttctggctctttttgtttttcgggaaaggaggcacgccacacatccagcacaaacagcaaagggggataattattaATG     glpT Gene: glpT     GI: 16077283     BI number: BSU02140     GOG: COG2271     Description: glycerol-3-phosphate permeas   c g  g a  c a  t a  a g  t a  c a  a t  t tg ta at aa        ga ta       g  g ag        ta gt        at t  |      g  g a  |      g  a tt       t  g        g ca       t  g      t  a aa       c  a      t  c gt        gg        ta g  a       aa        ta c  g       tg        cg cc        ac        cg tt       a  c       cg ct        ta        cg gg        tg        at                         gttttctggctctttttgtttttcgggaaaggaggcacgccacacatccagcacaaacagcaaagggggataattattaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG2271 Sugar phosphate permease ... can be seen here     ..................................................................................................................