                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:58 nt.    Distance to gene:120 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-13.00 kcal/mol
Antiterminator:    Distance from promoter:27 nt. Size=47 nt.     Delta G=-10.40 kcal/mol
Anti-antiterminator:    Distance from promoter:2 nt.    Size=48 nt.     Delta G=-12.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGATT-TATAAT. It has a score value of 71.62 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGATTACGTGCTAAATGGTTTATATAATGACTCGGGCTTAAGCGGTTCTCTTCCCCA
TTGAgggcaaggctagacgggacttaccgaaagaaaccatcaatgatggtttcttttttgttcataaatcagacaaaacttttctcttgcaaaagtt
tgtgaagtgttgcacaatataaatgtgaaatacttcacaaacaaaaagacatcaaagagaaacataccctgcaaggatgattaATG

    ldh --- lctP Gene: ldh     GI: 16077374     BI number: BSU03050     GOG: COG0039     Description: L-lactate dehydrogenase Gene: lctP     GI: 16077375     BI number: BSU03060     GOG: COG1620     Description: L-lactate permeas   C C  C C  A       ct T  T      a  t T  T      g  a CG        gc TA        gc Cg        cg Tg       a  a Tg       g  a Gc       a  | |  a       ta |  a       cg G  g      g  a        a Cg       g  a      a  t Gc       a  a       cg At       a  |       ta A  |      c  |       at T  |       gc        cg Ta        gc        cg Cg       g  a       at G  a       At        at G  |       Gc        at Gc        Ta        gc Cg        Ta        at Tg        At        at Cg        Cg        at                         tttgttcataaatcagacaaaacttttctcttgcaaaagtttgtgaagtgttgcacaatataaatgtgaaatacttcacaaacaaaaagacatcaaagagaaacataccctgcaaggatgattaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG0039 Malate/lactate dehydrogenases ... can be seen here [C] COG1620 L-lactate permease ... can be seen here     ..................................................................................................................