                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:74 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-22.60 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -7.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCGCGGCATCTATATTTCCGAGAATCTAGAGTATGGCATTATCGGCTGGAATGACGGC
GGACCGTCAGCGGTTCAAGCGCCATTCGGCGGAATGAAAGAAAGCGGCATCGGCCGTG
AAGGCGGTTCAGAAGGTATCGAGCCGTACCTTGAAACAAAATATTTGTCCATCGGTTT
ATAAaagaatgcacgctcctgagagctgccggattttccggcagctctttttgtgttccggcgaataatcacaacaattccagccaaaataacagca
aatacattttgaaagaaggttccccaacaATG

    glcU --- gdh Gene: glcU     GI: 16077460     BI number: BSU03920     GOG: COG4975     Description: - Gene: gdh     GI: 16077461     BI number: BSU03930     GOG: COG1028     Description: glucose 1-dehydrogenas gc t  a a  c a  g gc at a  c A  c At Tg         t A  a      t  t Tg       a  t Ta        gc Tg        gc Gc        cg Gt        cg Cg        gc T  c       ta A  c       cg Cg        gc Cg        at Ta        gc Gt        at             ttttgtgttccggcgaataatcacaacaattccagccaaaataacagcaaatacattttgaaagaaggttccccaacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG4975 Putative glucose uptake permease ... can be seen here [IQR] COG1028 Dehydrogenases with different specificities (related to short-chain alcohol dehydrogenases) ... can be seen here     ..................................................................................................................