                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:81 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-10.90 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -3.36 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G= -4.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGGCTTCCTCCTCCGTTACGCTGAACGGCGAACCGGTAAATCTCGGCTACACCATCG
GCGCCCTGTCGGATGCATCATTATCATGGACATATGACGGCGTAGATTACCTTCTCTC
TTCTAAAGATCTTTCTAAAGAGGAAATGGTGACAGTAGCGAAAAGCATGCAGGGACAA
TCATCGAAATAAccgccaaaggccaaacatgatttggcctttttttcgttagacatcgtttccctttagcctttaattttagtatgatatg
taaatgatattgaataaaagctaggaagtgtcgtaATG

    alr Gene: alr     GI: 16077531     BI number: BSU04640     GOG: COG0787     Description: D-alanine racemas             T           A  A   A       A  A A  G      A  c A  C       Gc A  A       Cg GT       T  c CG       A  c GC       C  a |  A      T  a |  G      A  a |  G      A  g        t A  G      C  g      a  g TA       A  |      c  a GC        Gc        at A  A       Gc        at C  A      G  a       at AT       A  a       cg GC       C  a       cg TA        Gc        gc GT        Ta        gc GC        At        at TG        Cg        at                         tttttcgttagacatcgtttccctttagcctttaattttagtatgatatgtaaatgatattgaataaaagctaggaagtgtcgtaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0787 Alanine racemase ... can be seen here     ..................................................................................................................