Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:94 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -9.70 kcal/mol
Antiterminator: Size=79 nt.     Delta G=-13.35 kcal/mol
Anti-antiterminator:   Size=34 nt.     Delta G=-14.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ggagtgccctaagggtgcaaccaaaataatcctatacaaatatGGTCCGGTAGTTCAGTTGGTTAGAATGCCTGCC
TGTCACGCAGGAGGTCGCGGGTTCGAGTCCCGTCCGGACCGCCAttaatgtaaacgaaacgatcatg
ttttcgttttttttgtgttttcttttactgtatcttctgcttggtgtcatagccaagctttctttatatcgggaacatcttggatattccagcaaaattc
gataaactaggaagagcacaaataggcataagcagggttgaaaggaggttttggttcATG

   㺗S --- rrnE --- 5S --- trnE --- Met


Gene: thiL     GI: 16077657     BI number: BSU05900     GOG: COG0611     Description: thiamine-monophosphate kinase
Gene: ydiB     GI: 16077658     BI number: BSU05910     GOG: COG0802     Description: -
Gene: ydiC     GI: 16077659     BI number: BSU05920     GOG: COG1214     Description: -
Gene: ydiD     GI: 16077660     BI number: BSU05930     GOG: COG0456     Description: -
Gene: gcp     GI: 16077661     BI number: BSU05940     GOG: COG0533     Description: O-sialoglycoprotein endopeptidas


           tg
          a  t
          c  t
          t  t
           at
           gc
           cg
           at
           at
           at
           gt
          c  t
           at
           at
           at
           tg
          g  t
          t  g
           at
           at
          |  t
          |  t
          |  c
          |  t
          |  t
          |  t
          |  t
          |  a
          |  c
          |  t
          |  g
  G       |  t
C  A      |  a
T  G      |  t
T  T      |  c
 GC       |  t
 GC       |  t
 GC       |  c
 CG       |  t
 GT       |  g
|  C      t  c       ca
|  C      t  t      t  t
|  G       At       g  a
 CG        Cg        tg
 TA        Cg        gc
 GC        Gt        gc
 GC       C  |       ta
A  G       Cg        ta
 GC        At        cg
 GC        Gc        gc
                        tttctttatatcgggaacatcttggatattccagcaaaattcgataaactaggaagagcacaaataggcataagcagggttgaaaggaggttttggttcATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[H] COG0611 Thiamine monophosphate kinase ... can be seen here
[R] COG0802 Predicted ATPase or kinase ... can be seen here
[O] COG1214 Inactive homolog of metal-dependent proteases, putative molecular chaperone ... can be seen here
[R] COG0456 Acetyltransferases ... can be seen here
[O] COG0533 Metal-dependent proteases with possible chaperone activity ... can be seen here

    ..................................................................................................................