                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:168 nt.    Distance to gene:37 nt.     Distance to run of Ts=1 nt.   Size=24 nt.     Delta G=-11.20 kcal/mol
Antiterminator:    Distance from promoter:120 nt. Size=60 nt.     Delta G=-12.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGATA-TATGCC. It has a score value of 68.94 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGATATTTACGGGATCTTCCGTTATGCCAATACGTATCCAAAGGGAATCGAATTTCT
TGCTTCAGGCATTGTGGACACGAAGCATCTAGTAACGGACCAATATTCGCTGGAGCAG
ACGCAAGATGCGATGGAGCGGGCGCTTCAATTTAAGAATGAATGTTTAAAAGTGATGG
TGTATCCAAATCGCTGAgtgaacagggaggatcttcgtattctccctcttgtttactggaaatgaaaacggattcttggggtgggaaa
tgATG

    gutP Gene: gutP     GI: 16077683     BI number: BSU06160     GOG: COG2211     Description: H+-symporte   T G  A T  T GC GC TA |  A |  A AT GC TG GC AT |  G A  A A  g At Tg Ta Ta Gc Ta        tc |  g      t  g |  g      c  t A  g       ta A  a       at G  g       gt T  g       gc A  a       at At        gc Gc        gc At        gc At        at             cttgtttactggaaatgaaaacggattcttggggtgggaaatgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG2211 Na+/melibiose symporter and related transporters ... can be seen here     ..................................................................................................................