                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:70 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -9.30 kcal/mol
Antiterminator: Size=71 nt.     Delta G=-29.13 kcal/mol
Anti-antiterminator:   Size=69 nt.     Delta G=-10.73 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTATTGATTCCATGAGAGACGAGCTGCTGCTGACAGGCGTCATCACGGGAATCGTTCT
GATTTCTTACCTTGTGTTCAGAAAACGCAAGGTGAGCGAGAAAGCGGCTGCCAACCCA
GTCACACAGCAGCAACCCGATATCCTGCCTTAAtgctgatcaaatcctaaacggcctgccgtttaggattttgtta
ttttcttcttcgggcgggctgcagcacgaagattttttgtaaccatcacgtccttattgtcattaactatagtaccaatttggaaaatttagataaggac
agatgaaaATG

    cotA Gene: cotA     GI: 16077697     BI number: BSU06300     GOG: COG2132     Description: spore coat protein (outer   A        ct G  T      c  g C  A       gc C  T       gc C  C       cg A  C       at AT        at CG        at GC        ta |  C       cg |  T       cg |  T       ta |  A       at |  A       at At        at Cg       c  t Gc        tg At        at Cg        gt A  a       ta C  t      |  t A  c      |  t C  a      |  t T  a      |  t G  a      |  c A  t      c  t       ct C  c      g  t      g  g C  c      t  c      g  c C  t      A  t      g  a A  a      A  t       cg A  a      T  c       gc C  a       Tg       g  a C  |       Cg        gc Gc        Cg        cg Tg        Gc        ta Cg        Tg        ta Gc        Cg        cg Gc        Cg        ta                         ttttttgtaaccatcacgtccttattgtcattaactatagtaccaatttggaaaatttagataaggacagatgaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [Q] COG2132 Putative multicopper oxidases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_subtilis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:102 nt.     Distance to run of Ts=1 nt.   Size=38 nt.     Delta G=-19.00 kcal/mol                                                                         Nomenclature/Definitions TTATTGATTCCATGAGAGACGAGCTGCTGCTGACAGGCGTCATCACGGGAATCGTTCT GATTTCTTACCTTGTGTTCAGAAAACGCAAGGTGAGCGAGAAAGCGGCTGCCAACCCA GTCACACAGCAGCAACCCGATATCCTGCCTTAAtgctgatcaaatcctaaacggcctgccgtttaggattttgtta ttttcttcttcgggcgggctgcagcacgaagattttttgtaaccatcacgtccttattgtcattaactatagtaccaatttggaaaatttagataaggac agatgaaaATG     cotA Gene: cotA     GI: 16077697     BI number: BSU06300     GOG: COG2132     Description: spore coat protein (outer           ct          c  g           gc           gc           cg           at           at           at           ta           cg           cg           ta           at           at           at          c  t           tg           at           gt             attttcttcttcgggcgggctgcagcacgaagattttttgtaaccatcacgtccttattgtcattaactatagtaccaatttggaaaatttagataaggacagatgaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [Q] COG2132 Putative multicopper oxidases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_subtilis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:111 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-16.20 kcal/mol                                                                         Nomenclature/Definitions TTATTGATTCCATGAGAGACGAGCTGCTGCTGACAGGCGTCATCACGGGAATCGTTCT GATTTCTTACCTTGTGTTCAGAAAACGCAAGGTGAGCGAGAAAGCGGCTGCCAACCCA GTCACACAGCAGCAACCCGATATCCTGCCTTAAtgctgatcaaatcctaaacggcctgccgtttaggattttgtta ttttcttcttcgggcgggctgcagcacgaagattttttgtaaccatcacgtccttattgtcattaactatagtaccaatttggaaaatttagataaggac agatgaaaATG     cotA Gene: cotA     GI: 16077697     BI number: BSU06300     GOG: COG2132     Description: spore coat protein (outer           ct          c  g           gc           gc           cg           at           at           at           ta           cg           cg           ta           at             tttgttattttcttcttcgggcgggctgcagcacgaagattttttgtaaccatcacgtccttattgtcattaactatagtaccaatttggaaaatttagataaggacagatgaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [Q] COG2132 Putative multicopper oxidases ... can be seen here     ..................................................................................................................