                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:62 nt.    Distance to gene:37 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-12.10 kcal/mol
Antiterminator:    Distance from promoter:44 nt. Size=29 nt.     Delta G= -8.80 kcal/mol
Anti-antiterminator:    Distance from promoter:43 nt.    Size=16 nt.     Delta G= -4.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgacc-tagaat. It has a score value of 84.34 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaccgcttatcgacgtgttgttagaattagtgaatattatcggagtctgggagcgagttggcctgactccggcaaacggccttgccaaagagggcgga
gcgagcttcatatctgtcctcgtttttttctgtgtcaaaaaacttagaggagattaggtgacaaccATG

    guaA Gene: guaA     GI: 16077703     BI number: BSU06360     GOG: COG0518,COG0519     Description: GMP synthetas            ca        ct           c  a      g  t           g  a      a  c            tg       g  a            ta       c  t            cg       g  a            cg        at gg       g  g       gc c  c       gc        gt a  c       cg        cg at       a  g       gt at       a  a       gc cg       a  |       gc gc        cg        at gc        gc        gc                         gtttttttctgtgtcaaaaaacttagaggagattaggtgacaaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG0518 GMP synthase - Glutamine amidotransferase domain ... can be seen here [F] COG0519 GMP synthase, PP-ATPase domain/subunit ... can be seen here     ..................................................................................................................