                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:24 nt.    Distance to gene:53 nt.     Distance to run of Ts=0 nt.   Size=40 nt.     Delta G=-14.10 kcal/mol
Antiterminator:    Distance from promoter:18 nt. Size=28 nt.     Delta G= -5.60 kcal/mol
Anti-antiterminator:    Distance from promoter:5 nt.    Size=26 nt.     Delta G= -4.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttctcc-taaaat. It has a score value of 70.95 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttctccttctcctcattttagtataaaatatatagggtattgtttcgaaaacacaggcctgtctcaaggcgttttgttgctttaaagggcttgtttttga
tatgatcagtattatatgacttaacggagaaatatgtggaggtggatcatATG

    gatC --- gatA --- gatB Gene: gatC     GI: 16077735     BI number: BSU06670     GOG: COG0721     Description: glutamyl-tRNA(Gln) amidotransferase (subunit C) Gene: gatA     GI: 16077736     BI number: BSU06680     GOG: COG0154     Description: glutamyl-tRNA(Gln) amidotransferase (subunit A) Gene: gatB     GI: 50812194     BI number: BSU06690     GOG: COG0064     Description: glutamyl-tRNA(Gln) amidotransferase (subunit B                      tt                     t  g                     t  t                      gt                      cg            ct        gc           t  c       gt   g       g  a       at c  a       ta        at ta        cg       c  a ta        cg       t  a ta        gc       c  a gc       g  |      t  | ta       a  |      g  | |  c      c  |       tg t  a      a  |       cg a  g       cg        cg tg        at        gc gc        at        gt gc        at        at gt        at        cg                         tttttgatatgatcagtattatatgacttaacggagaaatatgtggaggtggatcatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0721 Asp-tRNAAsn/Glu-tRNAGln amidotransferase C subunit ... can be seen here [J] COG0154 Asp-tRNAAsn/Glu-tRNAGln amidotransferase A subunit and related amidases ... can be seen here [J] COG0064 Asp-tRNAAsn/Glu-tRNAGln amidotransferase B subunit (PET112 homolog) ... can be seen here     ..................................................................................................................