                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:171 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -9.00 kcal/mol
Antiterminator: Size=71 nt.     Delta G= -9.75 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G= -5.56 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATAAACGAACAGGACTGGGAAAGCTTTTATTTAAACAGCAGGGAAACGAAACGGTTTT
TAGAAGAGCAATCTGCTTTTTATCAAAGCATCATGACAGGAAATTAAaatcccgacatcccggga
tttttttcatgccgaaaattgatcaaaaagaacaaaacggttttaaaaaattaaaaatacaaaaaaaccaaattatttacttgcggttggttttcccata
cgatggcaaaaaggcaagacaaaaaggggagtaagggagaaaaaaatgtaagcggattcatttaagggggaatggatGTG

    citM --- yflN Gene: citM     GI: 16077828     BI number: BSU07610     GOG: COG2851     Description: secondary transporter of divalent metal ions/citrate complexes Gene: yflN     GI: 16077829     BI number: BSU07620     GOG: COG0491     Description:             T           A  C           A  T            CG            GC            AT            GT            AT            AT            GT AA       |  A A  C      A  T G  G      T  C CG        TA AT        TA AT        TA AT        TG GT        GC GT       |  A G  A      |  T A  G      |  C C  |      |  A G  |      |  T A  |      |  G C  |      |  A A  |      |  C A  |      |  A A  |      |  G T  |      |  G T  |      G  A T  |      C  A A  |      A  A TA       A  T       at TA       A  T      c  c TG       G  A      a  c TA       C  A       gc CG       A  a       cg GC       A  a       cg A  A       At        cg A  A       Gc        ta AT        Gc        at GC        Gc        at                         tttttcatgccgaaaattgatcaaaaagaacaaaacggttttaaaaaattaaaaatacaaaaaaaccaaattatttacttgcggttggttttcccatacgatggcaaaaaggcaagacaaaaaggggagtaagggagaaaaaaatgtaagcggattcatttaagggggaatggatGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG2851 H+/citrate symporter ... can be seen here [R] COG0491 Zn-dependent hydrolases, including glyoxylases ... can be seen here     ..................................................................................................................