                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:70 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-18.30 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -6.96 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G=-11.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGAAATCGTGGGTGTCTCGATGATTGGCCCGGATGTAACCGAGCTCATCGGCCAAGC
GGCAGCGATCATGAATGGTGAGATGACGGCAGATATGGCGGAGCATTTTATCGCCGCC
CATCCGACTTTATCGGAAACATTGCATGAGGCGCTGTTAAGCACGATCGGCCTTGCGG
TACATGCATAAtaaaggaaaaagcaggcgcatggatataaggcgcctgcttttttattgttgaaagcgctttatttttcccctacaatagat
gaaaacggcgtgtaagggaggagcgatcaaggaaATG

    acoR --- sspH Gene: acoR     GI: 16077877     BI number: BSU08100     GOG: COG3284     Description: transcriptional regulator Gene: sspH     GI: 16077878     BI number: BSU08110     GOG: NOG43192     Description: small acid-soluble spore protei   A G  T        a C  C      a  g A  G      a  g CG       t  a GC       A  a A  C      A  a A  T      T  a        t T  T      A  a      a  a TG        Cg       g  t GC        Gc       g  a TG        Ta       t  a CG       A  g      a  g GT       C  |       cg C  A      A  |       gc G  |       Tg        cg G  |       Gc        gc A  |      G  |       gc GC        Cg        at TA        Gc        cg AT        Ta        gc CG       T  t       at GC        Cg        at TA        Cg        at                         tttattgttgaaagcgctttatttttcccctacaatagatgaaaacggcgtgtaagggaggagcgatcaaggaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [QK] COG3284 Transcriptional activator of acetoin/glycerol metabolism ... can be seen here     ..................................................................................................................