                                                                        Gene putatively regulated by attenuation in B_subtilis

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:163 nt.    Distance to gene:57 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-16.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTTTT-TAAGAT. It has a score value of 74.3 and is shown in blue

TTTTTTTCAGATTGATTTTATGATAAGATGAgtgcgaaatcaatagttactgggggtgcccgctttcgggctgagag
agaaggcaagcttcttaaccctttggacctgatctggttcgtaccagcgtggggaagtagaggaattgtttttgttattgtcttgctgggcaataatatg
tttctttctgactgtaaccgggttcatttatatgaatccggttttttgtgctggttatgggcttgattttgtcctttcaaacgtagaaaggggaaggaaa
agtaATG

    thiC Gene: thiC     GI: 16077944     BI number: BSU08790     GOG: COG0422     Description:           ta          t  t           ta           at           cg           ta           ta           gt           gc           gc           cg           cg           at           at             ttttgtgctggttatgggcttgattttgtcctttcaaacgtagaaaggggaaggaaaagtaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0422 Thiamine biosynthesis protein ThiC ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_subtilis This operon is putativelly rgulated by Thiamine_Thi-box                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:120 nt.    Distance to gene:97 nt.     Distance to run of Ts=2 nt.   Size=26 nt.     Delta G= -9.50 kcal/mol Antiterminator:    Distance from promoter:96 nt. Size=38 nt.     Delta G= -5.80 kcal/mol Anti-antiterminator:    Distance from promoter:67 nt.    Size=44 nt.     Delta G=-15.10 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TTTTTT-TAAGAT. It has a score value of 74.3 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTTTTTTCAGATTGATTTTATGATAAGATGAgtgcgaaatcaatagttactgggggtgcccgctttcgggctgagag agaaggcaagcttcttaaccctttggacctgatctggttcgtaccagcgtggggaagtagaggaattgtttttgttattgtcttgctgggcaataatatg tttctttctgactgtaaccgggttcatttatatgaatccggttttttgtgctggttatgggcttgattttgtcctttcaaacgtagaaaggggaaggaaa agtaATG     thiC Gene: thiC     GI: 16077944     BI number: BSU08790     GOG: COG0422     Description: cg t  t ta gc gc        tg ta       t  t cg        at |  c       at tg        gt at       g  t g  g      a  g       gc tg        gt       t  t cg        at        tg cg        ta        cg |  a       gt        tg a  a       at        gc g  g      a  g       ta gt       g  t       ta ta        gc        at tg        gt        ta ta        gt        ta cg        tg        gt cg        gc        ta                         tgtttctttctgactgtaaccgggttcatttatatgaatccggttttttgtgctggttatgggcttgattttgtcctttcaaacgtagaaaggggaaggaaaagtaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0422 Thiamine biosynthesis protein ThiC ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................