                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:61 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-15.50 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -7.80 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G= -7.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tggatagaaaataaacatgtccaatgctcaaaccatttctcttcactgaattgatgaattcttcatgtatgaagcaaattgtcaaatgaggtgtttatcg
caggaatcgttaggcattaaacaagtcttcattttattgacaaatgaggtgcttaccaaaggcataacacattttcttcatataagctcttcctctgcat
tcagggtgaacgctcgccgttcatcctgttttctattttctgcatttctgtggtacgatgaatgtatacatactaaacaatttcataaggaggaaccctc
ATG

    hit Gene: hit     GI: 16078067     BI number: BSU10030     GOG: COG0537     Description: Hit-like protei ca a  c a  a t  t a  t c  t gt gc at at |  c a  a       at c  t      c  t c  a       gc         c at        ta       t  g ta        cg       c  c ta        tg        gc cg        cg        cg gc       |  t       at |  t       cg        at |  c       ta        gc |  t       ta        ta t  t      c  c       gt gc       t  |       gc gc        cg        gc at        gc        at gc        at        cg                         ttttctattttctgcatttctgtggtacgatgaatgtatacatactaaacaatttcataaggaggaaccctcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [FGR] COG0537 Diadenosine tetraphosphate (Ap4A) hydrolase and other HIT family hydrolases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_subtilis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:68 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-15.50 kcal/mol Antiterminator: Size=30 nt.     Delta G= -7.80 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case tggatagaaaataaacatgtccaatgctcaaaccatttctcttcactgaattgatgaattcttcatgtatgaagcaaattgtcaaatgaggtgtttatcg caggaatcgttaggcattaaacaagtcttcattttattgacaaatgaggtgcttaccaaaggcataacacattttcttcatataagctcttcctctgcat tcagggtgaacgctcgccgttcatcctgttttctattttctgcatttctgtggtacgatgaatgtatacatactaaacaatttcataaggaggaaccctc ATG     hit Gene: hit     GI: 16078067     BI number: BSU10030     GOG: COG0537     Description: Hit-like protei ta a  t ca         c ta       t  g tg       c  c cc        gc tt        cg |  c       at tt        at tt        gc tc        ta a  c       gt c  |       gc at        gc cc        at at        cg             ttttctattttctgcatttctgtggtacgatgaatgtatacatactaaacaatttcataaggaggaaccctcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [FGR] COG0537 Diadenosine tetraphosphate (Ap4A) hydrolase and other HIT family hydrolases ... can be seen here     ..................................................................................................................