                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:162 nt.     Distance to run of Ts=1 nt.   Size=36 nt.     Delta G=-12.00 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -5.20 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G= -5.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGTGGTAGACTGCCCAGTACCGCAAAGCCTATTAAACGATCCGCCAAACGAGTTTTAT
GGATGGGCTGATTCTTTTAGAAGCGAGTTAATCAATTGGATTGCATCAACTCAGAATG
ATTGGGTTGAGATCCCTTCTTTTAGTGATGGTTTTAGATCTCAGGAAGTATTAGAAAT
GTTCTTTGAGAAAGACAGCAACTCTCAACCCATGTCTGTTTCAGCAGTCAACTAGtatt
tcaaagagagaagttactaaaaaagcaggaatttactttcctgctttttcatataggggtgtaatgaATG

    glcP Gene: glcP     GI: 16078116     BI number: BSU10520     GOG: COG0738     Description: glucose/mannose:H+ symporte            CA           T  A   T        AT T  T       AT G  T       TG         T A  A       TG       A  G GT       G  A      A  A CG        AT        GT |  G       GT        AT A  A       CG        CG A  T       GC        TG A  G      A  A       CG CG        AT        AT CG        GC        AT GC       |  A       CG C  T      A  A       TA CG       T  C      A  | TA       T  T      C  | AT       T  C      G  | GT        TA        TG C  C       CG        TA AT        TA        AT AT        TA        GC AT        AT        GC                         CTTCTTTTAGTGATGGTTTTAGATCTCAGGAAGTATTAGAAATGTTCTTTGAGAAAGACAGCAACTCTCAACCCATGTCTGTTTCAGCAGTCAACTAGtatttcaaagagagaagttactaaaaaagcaggaatttactttcctgctttttcatataggggtgtaatgaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0738 Fucose permease ... can be seen here     ..................................................................................................................