                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:29 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-18.90 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -9.10 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G= -6.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AATGCCGAAGCGGATAAACTCATGAAAGATGCAAAATCAATCAGTGACAGAAAGCAGT
ATTCAAAAGAATATGAGCAAATCTATCAAAAAATTGCGGAAGATCAGCCGTATACGTT
CTTGTATTATCCTAACAACCATATGGCAATGCCGGAAAATCTTGAAGGATACAAATAT
CATCCGAAACGTGATTTGTATAATATTGAAAAATGGTGGCTTGCAAAATAAatttcccttaa
aggggagggagagcgttttctccctcttctgtttttaataaggaaagtaaagggggacaagtatATG

    appB --- appC Gene: appB     GI: 16078204     BI number: BSU11390     GOG: COG0601     Description: oligopeptide ABC transporter (permease) Gene: appC     GI: 16078205     BI number: BSU11400     GOG: COG1173     Description: oligopeptide ABC transporter (permease AA G  A TA TA AT        aa TG       t  a |  G       tg |  T       cg |  G       cg A  G       cg A  C       ta T  T       tg AT        tg        gt TG       a  g      c  t GC       A  a       gt TA       A  |       at TA       T  |       gc TA       A  |       at A  A      A  |       gc GT       A  |       gc TA       A  |       gc G  A      C  |       at C  a      G  |       gc At        Tg        gt At        Ta        gt At        Cg        gc Gc        Gc        at                         gtttttaataaggaaagtaaagggggacaagtatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EP] COG0601 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here [EP] COG1173 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here     ..................................................................................................................