                                                                        Gene putatively regulated by attenuation in B_subtilis

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:161 nt.    Distance to gene:19 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-16.90 kcal/mol
Antiterminator:    Distance from promoter:115 nt. Size=63 nt.     Delta G=-17.91 kcal/mol
Anti-antiterminator:    Distance from promoter:84 nt.    Size=49 nt.     Delta G=-15.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgacc-taatat. It has a score value of 72.29 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaccaaataaggattcgtgttaatatagaggtgcagaacaattcaatatgtattcgtttaaccactaggggtgtccttcataagggctgagataaaag
tgtgacttttagaccctcataacttgaacaggttcagacctgcgtagggaagtggagcggtatttgtgttattttactatgccaattccaaaccactttt
ccttgcgggaaagtggtttttttattttcagagggggaatgatttGTG

    tenA --- tenI --- goxB --- thiS --- thiG --- thiF --- yjbV Gene: tenA     GI: 16078230     BI number: BSU11650     GOG: COG0819     Description: transcriptional regulator Gene: tenI     GI: 16078231     BI number: BSU11660     GOG: COG0352     Description: transcriptional regulator Gene: goxB     GI: 16078232     BI number: BSU11670     GOG: COG0665     Description: glycine oxidase Gene: thiS     GI: 16078233     BI number: BSU11680     GOG: COG2104     Description: - Gene: thiG     GI: 16078234     BI number: BSU11690     GOG: COG2022     Description: - Gene: thiF     GI: 16078235     BI number: BSU11700     GOG: COG0476     Description: - Gene: yjbV     GI: 16078236     BI number: BSU11710     GOG: COG0351     Description:            at           t  t           t  t            gt            ta            gc           t  t           t  |            ta            at ca        tg t  g       gc ta        gc gc       |  a gc       c  a at        gt cg        at a  c       gc a  g       gc gt        ta ta       |  a tg       |  a       tg cg       |  c      t  c |  g      |  c       cg |  a      |  a       cg a  a      |  c       tg a  g      |  t       ta t  t       gt        ta a  g       at        ta cg        at        cg ta        gc        at cg        gc        cg |  c       gt        cg cg        at        at cg        tg        at at        gc        at                         ttttattttcagagggggaatgatttGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0819 Putative transcription activator ... can be seen here [H] COG0352 Thiamine monophosphate synthase ... can be seen here [E] COG0665 Glycine/D-amino acid oxidases (deaminating) ... can be seen here [H] COG2104 Sulfur transfer protein involved in thiamine biosynthesis ... can be seen here [H] COG2022 Uncharacterized enzyme of thiazole biosynthesis ... can be seen here [H] COG0476 Dinucleotide-utilizing enzymes involved in molybdopterin and thiamine biosynthesis family 2 ... can be seen here [H] COG0351 Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_subtilis This operon is putativelly rgulated by Thiamine_Thi-box                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:165 nt.    Distance to gene:26 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-10.10 kcal/mol Antiterminator:    Distance from promoter:128 nt. Size=63 nt.     Delta G=-17.91 kcal/mol Anti-antiterminator:    Distance from promoter:113 nt.    Size=41 nt.     Delta G=-11.50 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgacc-taatat. It has a score value of 72.29 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgaccaaataaggattcgtgttaatatagaggtgcagaacaattcaatatgtattcgtttaaccactaggggtgtccttcataagggctgagataaaag tgtgacttttagaccctcataacttgaacaggttcagacctgcgtagggaagtggagcggtatttgtgttattttactatgccaattccaaaccactttt ccttgcgggaaagtggtttttttattttcagagggggaatgatttGTG     tenA --- tenI --- goxB --- thiS --- thiG --- thiF --- yjbV Gene: tenA     GI: 16078230     BI number: BSU11650     GOG: COG0819     Description: transcriptional regulator Gene: tenI     GI: 16078231     BI number: BSU11660     GOG: COG0352     Description: transcriptional regulator Gene: goxB     GI: 16078232     BI number: BSU11670     GOG: COG0665     Description: glycine oxidase Gene: thiS     GI: 16078233     BI number: BSU11680     GOG: COG2104     Description: - Gene: thiG     GI: 16078234     BI number: BSU11690     GOG: COG2022     Description: - Gene: thiF     GI: 16078235     BI number: BSU11700     GOG: COG0476     Description: - Gene: yjbV     GI: 16078236     BI number: BSU11710     GOG: COG0351     Description:            aa           c  t           c  t            gc            tc            aa           t  a           c  |            aa            tc            tc            ta            tc           |  t           a  t   a        tt t  t       tt g  t       gc gt        tc cg        gt gt       |  t a  g      |  g gt       |  c gt       |   ta       |   gt       |         tg at       |        t  c at        t        cg g  t       t        cg g  a       t        tg gc        a        ta at        t        ta ta        g        ta gt        g        cg cg        c        at gc        g        cg                         gtttttttattttcagagggggaatgatttGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0819 Putative transcription activator ... can be seen here [H] COG0352 Thiamine monophosphate synthase ... can be seen here [E] COG0665 Glycine/D-amino acid oxidases (deaminating) ... can be seen here [H] COG2104 Sulfur transfer protein involved in thiamine biosynthesis ... can be seen here [H] COG2022 Uncharacterized enzyme of thiazole biosynthesis ... can be seen here [H] COG0476 Dinucleotide-utilizing enzymes involved in molybdopterin and thiamine biosynthesis family 2 ... can be seen here [H] COG0351 Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................