                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:110 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-15.60 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -6.71 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGCTAACAAACAAGTAAACCGCCAAAAACTTCTCATCGAATGTTCCCGCGGCGTAAA
CGTCACAACAGTAGATGCCGATATCGCAACCCTTATTTCTACAGCAACAAATACACTC
GTAGCCATCCTAGTTATCACTCTTGTCCTCTAGgacctaaaagcagagctaaaaacgctctgctttttcttatttt
ccaagcatatgatgaatatatagacgttcacccacaccaagtggggcacgggtacatatgttgttaaggactaaagtcaaataccctataaagaaggagc
tgaaatcaATG

    cotY Gene: cotY     GI: 16078240     BI number: BSU11750     GOG: NOG47813     Description: spore coat protein (insoluble fraction CT         a T  A      a  a CG       a  a Cg       t  c Ta        cg Gc        gc |  c       at T  t       gc T  a       at C  a       cg T  a       gc C  a       at A  g       at C  c       at T  a       at A  g      t  | Ta       c  | Tg       c  | Gc        at At        gc Ta        Gt             tattttccaagcatatgatgaatatatagacgttcacccacaccaagtggggcacgggtacatatgttgttaaggactaaagtcaaataccctataaagaaggagctgaaatcaATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_subtilis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:117 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-11.00 kcal/mol Antiterminator: Size=41 nt.     Delta G= -6.71 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CAGCTAACAAACAAGTAAACCGCCAAAAACTTCTCATCGAATGTTCCCGCGGCGTAAA CGTCACAACAGTAGATGCCGATATCGCAACCCTTATTTCTACAGCAACAAATACACTC GTAGCCATCCTAGTTATCACTCTTGTCCTCTAGgacctaaaagcagagctaaaaacgctctgctttttcttatttt ccaagcatatgatgaatatatagacgttcacccacaccaagtggggcacgggtacatatgttgttaaggactaaagtcaaataccctataaagaaggagc tgaaatcaATG     cotY Gene: cotY     GI: 16078240     BI number: BSU11750     GOG: NOG47813     Description: spore coat protein (insoluble fraction TT C  G TT CC AC CT |  C T  T A  A T  G T  g        a G  a      a  a A  c      a  a T  c      t  c C  t       cg C  a       gc Ta        at Aa        gc Ca        at Cg        cg Gc        gc             tttttcttattttccaagcatatgatgaatatatagacgttcacccacaccaagtggggcacgggtacatatgttgttaaggactaaagtcaaataccctataaagaaggagctgaaatcaATG     ..................................................................................................................