                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:75 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-14.30 kcal/mol
Antiterminator: Size=31 nt.     Delta G= -6.80 kcal/mol
Anti-antiterminator:   Size=34 nt.     Delta G= -6.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCCGCGTCCGAGACCGCCATTTTATCCGCCTTATTATTATCCAAGACCGTATTATCCG
TTCTACCCGTTTTATCCGCGCCCGCCTTATTACTACCCGCGCCCGCGACCGCCTTACT
ACCCTTGGTACGGTTACGGCGGAGGTTATGGCGGAGGATATGGGGGAGGTTACGGTTA
CTAGtcgccacatatcaaaatgggggcagtccagctccccatttttttgttttaaaaatgacaatatcatgacaaatatgggaaataattgtgattc
tgtccccctcttgttacgataacaaaagcATG

    ctaO Gene: ctaO     GI: 16078273     BI number: BSU12080     GOG: COG0109     Description: heme O synthase activit   G C  G A  T T  T       tc TA       a  a       tc GC       t  a      g  c GT       a  a      a  a |  A      c  a       cg |  G       at        gc At        cg       |  t Gc        cg        gc G  g      g  g       gc Gc        cg        gc Gc        tg        gc |  a       Gc        ta Gc       A  |       at Ta        Ta        at At        Cg        at Ta        At        at                         tttgttttaaaaatgacaatatcatgacaaatatgggaaataattgtgattctgtccccctcttgttacgataacaaaagcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0109 Polyprenyltransferase (cytochrome oxidase assembly factor) ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_subtilis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:81 nt.     Distance to run of Ts=1 nt.   Size=18 nt.     Delta G= -9.70 kcal/mol Antiterminator: Size=31 nt.     Delta G= -6.80 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TCCGCGTCCGAGACCGCCATTTTATCCGCCTTATTATTATCCAAGACCGTATTATCCG TTCTACCCGTTTTATCCGCGCCCGCCTTATTACTACCCGCGCCCGCGACCGCCTTACT ACCCTTGGTACGGTTACGGCGGAGGTTATGGCGGAGGATATGGGGGAGGTTACGGTTA CTAGtcgccacatatcaaaatgggggcagtccagctccccatttttttgttttaaaaatgacaatatcatgacaaatatgggaaataattgtgattc tgtccccctcttgttacgataacaaaagcATG     ctaO Gene: ctaO     GI: 16078273     BI number: BSU12080     GOG: COG0109     Description: heme O synthase activit GT G  T C  A A  C T  T TA GG Gt        tc A  c      g  c Gg       a  a Gc        cg Gc        gc G  |       gt Ga        gc Tc        gc Aa        gc             catttttttgttttaaaaatgacaatatcatgacaaatatgggaaataattgtgattctgtccccctcttgttacgataacaaaagcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0109 Polyprenyltransferase (cytochrome oxidase assembly factor) ... can be seen here     ..................................................................................................................