                                                                        Gene putatively regulated by attenuation in B_subtilis

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:171 nt.    Distance to gene:27 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-14.40 kcal/mol
Antiterminator:    Distance from promoter:116 nt. Size=70 nt.     Delta G=-27.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttaca-tattat. It has a score value of 79.65 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttacaaaatgattcttatcatctattatgatgttaaaataaaaaattgtatacggaaagcactaggggtgctgttttggctgagataaagcgcggaaga
aacgcgctttgatcccttatgacccgatctggataataccagcgtggggaagtgcaggttgaccgaatggtgtatttttttgtgcgcttaatcgatctat
gactgcatattcccttaggatatgcagttttttattttaccaaaaaaacaggaggtcggagaaATG

    ykoF --- ykoE --- ykoD Gene: ykoF     GI: 16078389     BI number: BSU13240     GOG: NOG13653     Description: - Gene: ykoE     GI: 16078388     BI number: BSU13230     GOG: COG4721     Description: - Gene: ykoD     GI: 16078387     BI number: BSU13220     GOG: COG1122     Description: tt t  t t  t tg at tg gc tg gc gt |  t t  a a  a at gc cg c  a at gc |  t |  a t  t t  g        t g  a      c  t gc       c  a at        cg cg        tg gc        ta ta        at gt        ta |  a       at at        cg at        gc gc        ta gc        cg gc        at gt        gt             ttttattttaccaaaaaaacaggaggtcggagaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4721 Predicted membrane protein ... can be seen here [P] COG1122 ABC-type cobalt transport system, ATPase component ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................