                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:78 nt.    Distance to gene:146 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-15.50 kcal/mol
Antiterminator:    Distance from promoter:42 nt. Size=47 nt.     Delta G=-11.20 kcal/mol
Anti-antiterminator:    Distance from promoter:23 nt.    Size=29 nt.     Delta G= -8.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTCAGA-TAAAAT. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCAGAAAATAAAGAATACGGCAACGGTAAAATTACGCTAAGCCCTGAGGGTGCACAG
CTGCTTCTCGAAGAAATTCAAGCCGCTTTAAAAGAATAAaattatgctaaaaaaggcggagtgatatcatc
tccgccttttttgcgtgccaatttttgattaccgccgcctaagataagacatcaagatatttggtaatgaatgatttgggatactttacatattttactc
aattatttgtcgaagaatggtacaataagtagagaaacacaagcggcaggtggtcatATG

    kinC --- ykqA Gene: kinC     GI: 16078513     BI number: BSU14490     GOG: COG0642,COG2202     Description: two-component sensor histidine kinase Gene: ykqA     GI: 16078514     BI number: BSU14500     GOG: COG2105,COG3703     Description:            aa           A  t            At            Ta            At           A  g            Gc            At AA       |  a G  A      A  a AT       A  a AT       A  a       ta GC        Ta       a  t C  |       Ta        gc T  |       Tg        ta C  |       Cg       |  t TA        Gc        gc TA        Cg        at CG        Cg        gc GC       G  a       gc T  C      A  g       cg CG        At        gc GC        Cg        gc AT        Ta        at                         tttttgcgtgccaatttttgattaccgccgcctaagataagacatcaagatatttggtaatgaatgatttgggatactttacatattttactcaattatttgtcgaagaatggtacaataagtagagaaacacaagcggcaggtggtcatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG0642 Signal transduction histidine kinase ... can be seen here [T] COG2202 FOG: PAS/PAC domain ... can be seen here [S] COG2105 Uncharacterized conserved protein ... can be seen here [P] COG3703 Uncharacterized protein involved in cation transport ... can be seen here     ..................................................................................................................