                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:67 nt.    Distance to gene:53 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -9.50 kcal/mol
Antiterminator:    Distance from promoter:29 nt. Size=48 nt.     Delta G= -5.70 kcal/mol
Anti-antiterminator:   Size=65 nt.     Delta G=-17.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGATA-AATCAT. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGATATGCACACAGAGGTTGAAATCATCGGCGGAAATCGCTGAttcaagttctgactgaagctgtt
catatgacatactgtaagcaaacgaacaaacggcatcatagtatgccgtttgttttggaatagacagacttttaacagctgtttcatttgaatgaggtga
acaggcaATG

    divIB --- ylxW --- ylxX --- sbp Gene: divIB     GI: 16078588     BI number: BSU15240     GOG: COG1589     Description: cell-division initiation protein Gene: ylxW     GI: 16078589     BI number: BSU15250     GOG: COG3879     Description: - Gene: ylxX     GI: 16078590     BI number: BSU15260     GOG: COG3879     Description: - Gene: sbp     GI: 16078591     BI number: BSU15270     GOG: COG3856     Description: small basic protei   A A  A G  T GC CG GC GT CG TA At C  | T  | A  | A  |       aa At       t  g Gc        gc Ta        ta Ta       c  a G  g      a  a Gt       t  c At       a  g Gc       c  a At       a  a Cg        gc |  a       ta |  c      a  | |  t      t  | |  g      a  | |  a      c  |       ta |  a       ta       a  g |  g       ta       c  t |  c       gc        ta At        tg        at Cg        cg        cg At        gc        gc C  t      a  a       gc Gc        at        cg Ta        gc        at At        ta        at                         tgttttggaatagacagacttttaacagctgtttcatttgaatgaggtgaacaggcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG1589 Cell division septal protein ... can be seen here [S] COG3879 Uncharacterized protein conserved in bacteria ... can be seen here [S] COG3879 Uncharacterized protein conserved in bacteria ... can be seen here [S] COG3856 Uncharacterized conserved protein (small basic protein) ... can be seen here     ..................................................................................................................