                                                                        Gene putatively regulated by attenuation in B_subtilis

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:189 nt.    Distance to gene:29 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-14.40 kcal/mol
Antiterminator:    Distance from promoter:139 nt. Size=62 nt.     Delta G=-21.84 kcal/mol
Anti-antiterminator:    Distance from promoter:107 nt.    Size=44 nt.     Delta G=-11.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGATA-TGGAAT. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGATACGCCAATCCATGTATTATGGAATCAGGATCGGCCGTTTTTAACAAGAGCTGA
GCCGATAACGAATGCCTGAcaaatatatatagattcatcctaggggtgctttgcgaagctgagagagactttgtctcaaccctttt
gacctgatctggatcatgccagcggagggaagcggtgaaaagcggagtacatcggactccgtttgtttttattaagccgtttcatcacatttgaaacggc
ttttttgattttaaagaataggagcggatttacaTTG

    ylmB Gene: ylmB     GI: 16078599     BI number: BSU15350     GOG: COG0624     Description:             t           a  c           c  g           a  g            ta            gc            at            gc            gc            cg            gt            at ca        at t  t      |  g a  g      |  t gc       |  t gc       |  t ta       |  t cg       |  t t  c      |  a a  |      |  t g  |      a  t t  |      a  a        c cg       g  a      a  a cg        tg       c  t a  a       gc       t  t g  g       gc        at tg        cg        cg tg        gt        ta ta        at        ta ta        at        ta cg        gc        gc |  c      g  a       cg cg       g  |       cg cg        at        gc at        gc        at                         tttttgattttaaagaataggagcggatttacaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0624 Acetylornithine deacetylase/Succinyl-diaminopimelate desuccinylase and related deacylases ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_subtilis This operon is putativelly rgulated by Thiamine_Thi-box                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:154 nt.    Distance to gene:63 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-10.60 kcal/mol Antiterminator:    Distance from promoter:96 nt. Size=67 nt.     Delta G=-18.00 kcal/mol Anti-antiterminator:    Distance from promoter:58 nt.    Size=68 nt.     Delta G=-18.20 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TTGATA-TGGAAT. It has a score value of 64.93 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTGATACGCCAATCCATGTATTATGGAATCAGGATCGGCCGTTTTTAACAAGAGCTGA GCCGATAACGAATGCCTGAcaaatatatatagattcatcctaggggtgctttgcgaagctgagagagactttgtctcaaccctttt gacctgatctggatcatgccagcggagggaagcggtgaaaagcggagtacatcggactccgtttgtttttattaagccgtttcatcacatttgaaacggc ttttttgattttaaagaataggagcggatttacaTTG     ylmB Gene: ylmB     GI: 16078599     BI number: BSU15350     GOG: COG0624     Description:   g        ca a  a      t  t g  g      a  g ta        gc cg        gc |  a       ta gc        cg at       t  c at       a  | gt       g  | cg       t  | gt        cg t  c       cg t  t      a  a t  c      g  g c  a       tg g  |       tg ta        ta gc        ta gc        cg gc       |  c gt        cg at        cg t  t       at         t c  t      |  g      a  c cg       a  a      c  g ta       c  a      a  g |  c      t  a       ta a  c      c  a       gc c  t       tg        at tg        gc        gc ta        tg        gc at        tg        cg gc        ta        gt at        cg        at tg        at        at                         gtttttattaagccgtttcatcacatttgaaacggcttttttgattttaaagaataggagcggatttacaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0624 Acetylornithine deacetylase/Succinyl-diaminopimelate desuccinylase and related deacylases ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................