                                                                        Gene putatively regulated by attenuation in B_subtilis

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:27 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-24.20 kcal/mol
Antiterminator: Size=36 nt.     Delta G=-11.01 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G=-10.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggtaccgcg is shown in italic-bold style

aatacgttcataaattcagatgaaaaaacggttgaaagggacagtcatgtttccttcaggccttcatagcgacccggagatggtgagagtccgggatggc
cggaatcatgtagatcagccctttagtttccttgctgaactcacagtaggttaggacgttcatcacgttacgatgctcaagaggaaaaagtgtatgcttg
ctttttctaaaagggtggtaccgcgagataagctttctcgtcccttatgggatgagagggctttttttattttctgaaaaaatgcagtggaggaatgaaa
ATG

    ileS Gene: ileS     GI: 16078607     BI number: BSU15430     GOG: COG0060     Description: isoleucyl-tRNA synthetas             g tg       a  c a  c      a  t t  t      t  t gt        at tg        gc        ta gc        at       t  t at        gc        cg at        cg        cg at        gt        cg at       c  |       ta at       c  |       gt gc       a  |       cg gt       t  |       ta a  a      g  |       cg g  a      g  |       ta a  a      t  |       tg a  a       gc        tg cg        gc        cg tg        gc        gc cg        at        at gt        at        at                         tttttattttctgaaaaaatgcagtggaggaatgaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0060 Isoleucyl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_subtilis This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:34 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-23.30 kcal/mol Antiterminator: Size=36 nt.     Delta G=-11.01 kcal/mol Anti-antiterminator:   Size=52 nt.     Delta G=-11.90 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case The T-box sequence: agggtggtaccgcg is shown in italic-bold style aatacgttcataaattcagatgaaaaaacggttgaaagggacagtcatgtttccttcaggccttcatagcgacccggagatggtgagagtccgggatggc cggaatcatgtagatcagccctttagtttccttgctgaactcacagtaggttaggacgttcatcacgttacgatgctcaagaggaaaaagtgtatgcttg ctttttctaaaagggtggtaccgcgagataagctttctcgtcccttatgggatgagagggctttttttattttctgaaaaaatgcagtggaggaatgaaa ATG     ileS Gene: ileS     GI: 16078607     BI number: BSU15430     GOG: COG0060     Description: isoleucyl-tRNA synthetas tg a  c t  t gt tg gc         a at       t  c at       g  c at       g  g at        tc at        gg gc        ga        ta gt        gg       t  t a  a       aa        cg g  a       at        cg a  a      a  |       cg a  |      a  |       ta c  |      t  |       gt ta       c  |       cg cg       t  |       ta g  g      t  |       cg tg       t  |       ta at        ta        tg g  g       ta        tg cg        cg        cg at        gc        gc ta        tt        at                         ttttttattttctgaaaaaatgcagtggaggaatgaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0060 Isoleucyl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................