                                                                        Gene putatively regulated by attenuation in B_subtilis

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:112 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -6.20 kcal/mol
Antiterminator: Size=34 nt.     Delta G=-10.90 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-10.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tagaattgtgctaaaatttactacaaatctaaaaacttatcaagagcggctgagggactggacctatgaagcccggcaacctgcatagtttgtaaggtgc
tacttccagcaaaatgaattccattttgaaagataagggctgcatgctgttcctgtctttctttccgccggattgaaagttttttattttaagaggtaaa
aaggctatctgtatatcagcagccgcgaatcacattacatgggaaaagacaaccggcagaaagctactgtttgtttgtctccgaaaggaggaaagaagaa
ATG

    cysH --- cysP Gene: cysH     GI: 16078621     BI number: BSU15570     GOG: COG0175     Description: phosphoadenosine phosphosulfate Gene: cysP     GI: 16078622     BI number: BSU15580     GOG: COG0306     Description: sulfate permeas   t a  t a  c gc ta at at at at cg g  a a  a c  a       at cg       c  g ta       g  c t  t      t  t c  a       cg a  |       gt         c ta        gt       g  c cg        gc        cg g  g      a  c       cg tg        at        ta gc        tg       t  t gt        at       t  t a  |       gc        cg a  |       at        ta tg        at        ta gc        at        ta ta        gc        cg                         ttttttattttaagaggtaaaaaggctatctgtatatcagcagccgcgaatcacattacatgggaaaagacaaccggcagaaagctactgtttgtttgtctccgaaaggaggaaagaagaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EH] COG0175 3'-phosphoadenosine 5'-phosphosulfate sulfotransferase (PAPS reductase)/FAD synthetase and related enzymes ... can be seen here [P] COG0306 Phosphate/sulphate permeases ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Methionine_S-box sequence ... can be seen here     ..................................................................................................................